ID: 1181069258

View in Genome Browser
Species Human (GRCh38)
Location 22:20322386-20322408
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181069257_1181069258 22 Left 1181069257 22:20322341-20322363 CCATTGTGCGCGCGCGCACACAC No data
Right 1181069258 22:20322386-20322408 AAAGTTCCTTTTCTTTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181069258 Original CRISPR AAAGTTCCTTTTCTTTTTCA TGG Intergenic