ID: 1181074157

View in Genome Browser
Species Human (GRCh38)
Location 22:20363843-20363865
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 2, 1: 0, 2: 2, 3: 14, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181074157_1181074162 -3 Left 1181074157 22:20363843-20363865 CCCTTGTCCCTGTGTTTAAACTT 0: 2
1: 0
2: 2
3: 14
4: 283
Right 1181074162 22:20363863-20363885 CTTGGTCATGCTTTTCCCAGAGG 0: 1
1: 1
2: 1
3: 21
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181074157 Original CRISPR AAGTTTAAACACAGGGACAA GGG (reversed) Intronic
902305984 1:15539695-15539717 ATATTTAAAGACAGGTACAATGG - Intronic
905019419 1:34798156-34798178 AAATTTAGACACAGAGACACAGG - Intronic
905208562 1:36357603-36357625 AATTTTAAAAAAAAGGACAAGGG + Intronic
905845448 1:41227364-41227386 AAATTTAAACAGAGTGACTATGG - Intronic
906044838 1:42820523-42820545 AAATTTAAAAACAGGGAAACTGG - Intronic
907107325 1:51895681-51895703 AAGTTTAGAAACAGGGCTAAAGG - Intergenic
907604550 1:55803741-55803763 AATTGGAAACACAGGGAAAAGGG - Intergenic
908054619 1:60270348-60270370 CAGTTTAAACTCAGGGAGTAGGG - Intergenic
908702705 1:66919853-66919875 AAGTCTCATCCCAGGGACAAGGG + Intronic
908953941 1:69598219-69598241 AAGTTTAGTCTCAGGGACATAGG - Intronic
910497352 1:87846577-87846599 AATTTTTGACAAAGGGACAAAGG + Intergenic
910843736 1:91585933-91585955 GAGCTTAAACACAGGGAGGAGGG + Intergenic
911722267 1:101204300-101204322 AAGTTCAAACACAGTGTCACAGG - Intergenic
912112213 1:106357362-106357384 AAGTACAAAGGCAGGGACAATGG + Intergenic
912729680 1:112091147-112091169 AAATCTAATCACAGGGATAATGG - Intergenic
913563059 1:120042575-120042597 CAGTTCAAGCAAAGGGACAAAGG + Intronic
913635064 1:120751015-120751037 CAGTTCAAGCAAAGGGACAAAGG - Intergenic
913990409 1:143606747-143606769 AAGATTAAACACAGAGAGATTGG + Intergenic
914283655 1:146201937-146201959 CAGTTCAAGCAAAGGGACAAAGG + Intronic
914471765 1:147985713-147985735 AAGTTTAAAAAAAGGAAAAAGGG - Intronic
914544686 1:148652673-148652695 CAGTTCAAGCAAAGGGACAAAGG + Intronic
914621941 1:149418336-149418358 CAGTTCAAGCAAAGGGACAAAGG - Intergenic
917021540 1:170593708-170593730 AAGTAGAAACACAGGGAAATAGG + Intergenic
917381556 1:174415235-174415257 AAGATTTAATACAGGGAAAAAGG - Intronic
917950758 1:180032357-180032379 AATTTTAAACACAGAAATAATGG - Intronic
920954615 1:210606970-210606992 GAATTTAAAGGCAGGGACAATGG - Intronic
921266377 1:213424125-213424147 AGGTTGAAACAGAGGCACAATGG - Intergenic
921590744 1:217000425-217000447 CAATTTGGACACAGGGACAAGGG - Intronic
921793813 1:219319745-219319767 AAGTTCAAACACATGTAGAAGGG - Intergenic
922415527 1:225419029-225419051 AGTTTTAAACACAGCTACAATGG + Intronic
924358139 1:243206026-243206048 CAGTTCAAAGCCAGGGACAAAGG + Intronic
924950348 1:248876501-248876523 AAGGTTAAACACTGGGACCCTGG - Intergenic
1064795657 10:19008543-19008565 CATTTTAAACAGAGTGACAAAGG - Intergenic
1065764935 10:29020045-29020067 AAGTTTGTGCCCAGGGACAAAGG + Intergenic
1066196862 10:33108743-33108765 AAGTTTAATCACAGGTGCACCGG + Intergenic
1068460786 10:57325461-57325483 AATTTTAAACATAGGCAAAAGGG - Intergenic
1070020897 10:72584915-72584937 AAGTTTAAACACTGCTCCAAAGG + Intronic
1070564591 10:77594124-77594146 AAGTGAAAAGAAAGGGACAATGG + Intronic
1070885222 10:79889407-79889429 CAGTTTAACCTCAGGGAAAACGG - Intergenic
1071130954 10:82393139-82393161 AAGTATCAACACTGAGACAAAGG + Intronic
1071837371 10:89431929-89431951 AAGAATTAACACAGGGAGAAAGG + Exonic
1072223218 10:93345273-93345295 AATTTTTAAAACAGGGATAATGG - Intronic
1072998131 10:100264831-100264853 AAGTTTAAAGCCAGGCACAGTGG + Intronic
1076432446 10:130414975-130414997 AAAATTAAACACTGGGAAAAGGG - Intergenic
1077220657 11:1414194-1414216 AATTTTAAACAACGGGACAATGG - Intronic
1078162731 11:8855779-8855801 AAATTTAAAGACAGGGATTAGGG + Intronic
1078960617 11:16264029-16264051 ATGATTACACACAGAGACAAAGG - Intronic
1079649908 11:22914925-22914947 AGGTCTAAACATAGCGACAAGGG + Intergenic
1079977680 11:27112244-27112266 AAGTTTAAACACAGTGTCCTTGG + Intronic
1080000357 11:27341242-27341264 AAGTTTAAACACAGCGTAACAGG + Intronic
1081108844 11:39106716-39106738 AAATTTGAACACAGAGACACAGG - Intergenic
1083979415 11:66153919-66153941 CACTTTAAACACAGAGACACAGG + Intronic
1084686858 11:70701280-70701302 AACTTTAAACAAAGAGAAAAAGG + Intronic
1084839540 11:71833819-71833841 GAATTTAAACACAGGAACCAGGG + Intronic
1084988872 11:72903936-72903958 AACATGAAACACAGGGATAAGGG + Intronic
1086482862 11:87261945-87261967 AAATATAAACATAGGTACAAAGG - Intronic
1087675560 11:101157933-101157955 AATTTTAATCACCAGGACAATGG + Intergenic
1088207557 11:107411857-107411879 ATATTTAAAGAGAGGGACAAAGG + Intronic
1088412159 11:109546279-109546301 AATTAAAAACACAGGCACAAGGG + Intergenic
1089060918 11:115625567-115625589 AAGTTCAAACCCAGGGAAGATGG - Intergenic
1089687728 11:120167660-120167682 AAGTTTAGTCACAGCGACGAGGG + Intronic
1090160957 11:124494842-124494864 AAGGTGAAACACAGAGAAAAAGG - Intergenic
1092975392 12:13739895-13739917 AAGTTTAAAAATAGGAACCATGG - Intronic
1094705555 12:32911111-32911133 AAATGTCAACACAGGGAAAAAGG - Intergenic
1095861902 12:46926524-46926546 AAGTTTAAAAAGAAGGAAAAAGG + Intergenic
1097498891 12:60377836-60377858 AAGGTTAATCACCGAGACAATGG + Intergenic
1097587757 12:61534729-61534751 AAGTTTATATTCAGGGACATTGG + Intergenic
1097776773 12:63656216-63656238 AAGTATAAACACGGAGAAAATGG - Intronic
1098192043 12:67959805-67959827 AAGTTGAAATACAGGGACACAGG + Intergenic
1098630182 12:72713396-72713418 AAGTGTAGAGACAGGGAGAAGGG + Intergenic
1099177824 12:79442137-79442159 AAGTTTCAACACATGAACACAGG + Intronic
1099446849 12:82762693-82762715 AAATAAAAACACAGGGAGAATGG + Intronic
1099939450 12:89168085-89168107 AAATTTAAACACATCAACAATGG + Intergenic
1100252198 12:92838441-92838463 AAAATCAAACAGAGGGACAAAGG + Intronic
1101790096 12:107918312-107918334 AAGTTTGAAGGCTGGGACAAAGG - Intergenic
1102188083 12:110965295-110965317 GAATTTAGACACAGGGACAGGGG + Intergenic
1102960477 12:117089944-117089966 AAATTTTAAAACAGGGAAAAGGG + Intronic
1103456702 12:121072987-121073009 AAATTTGAACACAGGCACAGAGG - Intergenic
1104200929 12:126588115-126588137 AACATTAAACACAGAGAGAAAGG + Intergenic
1106066717 13:26359598-26359620 GAGTTAAAACACATGGGCAAGGG + Intronic
1106282336 13:28286690-28286712 GGGTATAAACACAAGGACAAAGG - Intronic
1106305883 13:28508881-28508903 AAATTTGAACACAGGTACAGAGG + Intergenic
1108378780 13:49837405-49837427 AAGTTTAAACAAAATGAAAAAGG + Intergenic
1108714398 13:53064563-53064585 AAATTTCAACACAGAGACATGGG - Intergenic
1109608860 13:64737127-64737149 AAGTTTATACAAAGAAACAAAGG - Intergenic
1110271580 13:73597161-73597183 AAATTTAAACACAGGTACAAAGG - Intergenic
1110681468 13:78318411-78318433 TAGTTTACCCACAGGTACAAAGG - Intergenic
1110786172 13:79529424-79529446 AATTTTAAAAACTGGAACAATGG - Intronic
1111054563 13:82931832-82931854 AAATTTAGAGACAAGGACAATGG - Intergenic
1111404955 13:87791840-87791862 TAGTTTAAAAATATGGACAAAGG + Intergenic
1112283305 13:98081609-98081631 ACGTGTAAACACAGGGACTCAGG + Intergenic
1112925894 13:104675152-104675174 AAGTTTAGATGCAGGGACAGTGG + Intergenic
1118004902 14:61556702-61556724 AAAATTAAACAGTGGGACAAAGG + Intronic
1118032675 14:61833735-61833757 AATTTTAAACTCAAGGACCAGGG + Intergenic
1120431077 14:84416812-84416834 AACTGTAAACAGAGGGACAAAGG - Intergenic
1121754832 14:96393610-96393632 AAGTTTTGACACAGAGACACAGG - Intronic
1121923126 14:97901934-97901956 AAGGTTAATCACAGAGACAATGG + Intergenic
1122425739 14:101604407-101604429 AAGGTTAACTGCAGGGACAAAGG + Intergenic
1202830622 14_GL000009v2_random:25597-25619 AATGTTAAACACAGACACAAGGG - Intergenic
1124062315 15:26305904-26305926 AATGTTAAACACCAGGACAATGG + Intergenic
1126648644 15:50899930-50899952 AATTTTAAAAACAGCAACAATGG + Intergenic
1128351284 15:66891648-66891670 AGGTTTAAGCAAAGGGAAAAGGG - Intergenic
1129626424 15:77204944-77204966 AAGTTCAAAAAAAGGGAAAAGGG + Intronic
1132075506 15:98816636-98816658 ACATTAAAACACAGGCACAAGGG - Intronic
1133150705 16:3827278-3827300 AATTTTCAACACAAGAACAAAGG - Intronic
1133554730 16:6894779-6894801 AATTACAAACACAGGGAAAATGG - Intronic
1134615041 16:15644399-15644421 AAAATTAAATACAGGCACAAAGG - Intronic
1135150360 16:19999877-19999899 AAGTTTCAACACAAGGACTTTGG + Intergenic
1137319660 16:47367734-47367756 ATGTTTCTGCACAGGGACAATGG - Intronic
1139914571 16:70420108-70420130 AAGTTTGAACCCGGGGACAGAGG - Intronic
1140179189 16:72696817-72696839 AAGTTTAATTACGGAGACAAAGG - Intergenic
1141384599 16:83608292-83608314 CAGTTTTCACAAAGGGACAAAGG + Intronic
1143075399 17:4338353-4338375 AATTTTAAACACAGATACAATGG + Intronic
1144384073 17:14732535-14732557 AAGTATATTCACAGGGAAAAAGG - Intergenic
1144406881 17:14960420-14960442 AAGATCAAACACATGGAAAAAGG - Intergenic
1144644997 17:16966696-16966718 AAGTTTAATCACTGGGTCAGTGG - Intronic
1145204333 17:20974174-20974196 AAGTTTAATCACTGGGTCAGTGG + Intergenic
1147190007 17:38732879-38732901 AAGTTTTAACCCAGGAACATGGG + Intronic
1148722833 17:49766884-49766906 AAGTTTAAACACAGTATCCATGG - Intronic
1149031609 17:52089305-52089327 AAGTGTCACCACAGGGACCAAGG + Intronic
1151464869 17:74278101-74278123 AAGTATTAATACAGGGCCAAAGG - Intronic
1153474481 18:5483222-5483244 AAATTTAAAAACAGAAACAAAGG - Intronic
1155248791 18:23936431-23936453 AAGTTTGAACACTTGGACACAGG - Intronic
1156740346 18:40319083-40319105 AAGTGTAGACACAATGACAAAGG - Intergenic
1157909198 18:51599230-51599252 AAGTTGAAACTCAGGAAAAACGG - Intergenic
1160261279 18:77296508-77296530 AAATTTTAACACAGTGAAAAAGG + Intergenic
1161517613 19:4705049-4705071 CAGTGTAAACACAAGGACACTGG + Intronic
1162080217 19:8213478-8213500 AATTTTATACACATGGACAGGGG + Intronic
1166728822 19:45046062-45046084 ACGTTCACATACAGGGACAAAGG - Intronic
1168016436 19:53577312-53577334 AAGTTTATACACACGGCTAAAGG - Exonic
1202642075 1_KI270706v1_random:102181-102203 AATGTTAAACACAGACACAAGGG + Intergenic
925097043 2:1214103-1214125 AAGCATAAACACAGGTACATTGG - Intronic
926000053 2:9323371-9323393 AAATGTCAACACAGGGGCAAAGG - Intronic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
927791216 2:26011096-26011118 AAGTTCAAAAACAGGCACTATGG + Intergenic
928146396 2:28780862-28780884 AAGTATAAATAGAGGCACAAAGG - Intronic
929048788 2:37816564-37816586 AAGTCTGATCACAGGGAGAAGGG - Intergenic
929663074 2:43808940-43808962 AAGTAAAATCACTGGGACAAAGG + Intronic
932092075 2:68815171-68815193 ATGTCTACACACAGGGACCAAGG + Intronic
932554086 2:72803618-72803640 AATAATAAACACAGGGAAAAAGG + Intronic
933117276 2:78489969-78489991 AAGTTTAAAAAAAAGGAAAATGG + Intergenic
933152668 2:78933756-78933778 AACTTTAAACAAAGGTATAACGG - Intergenic
934065025 2:88332565-88332587 AAGTTACAACACAGAGAAAACGG - Intergenic
935881727 2:107572356-107572378 GATTTTAAACACAGGGTCAGGGG - Intergenic
936626971 2:114158800-114158822 AGATATACACACAGGGACAAAGG - Intergenic
936834532 2:116692035-116692057 AGGGTTAAATACAGAGACAAAGG - Intergenic
940778748 2:157911007-157911029 AAGTTTTCACACAGGAAGAAAGG - Intronic
941707780 2:168678165-168678187 AAATATCAACACAGTGACAAAGG + Intronic
941709945 2:168701433-168701455 AAATTTCAACACTGGGAGAAAGG - Intronic
943237075 2:185336622-185336644 AAGTTTATTCAAAGGGATAATGG - Intergenic
943284665 2:185982305-185982327 AAATTTAAACCCAGAGAAAAAGG + Intergenic
943993031 2:194721603-194721625 AAGTTTTAAAGCAGAGACAAAGG - Intergenic
945529355 2:210931277-210931299 AAGCTTATACACAGGGAGGAGGG - Intergenic
946487389 2:220114011-220114033 AAGTGTAAACACAGCATCAAGGG - Intergenic
947621239 2:231592622-231592644 AAGTACAACCACAGGGACACAGG - Intergenic
947896344 2:233676853-233676875 AAGTTTTTACAAAGGTACAAAGG - Intronic
948004558 2:234596633-234596655 AAGTTAAAAGGCAGGGGCAAGGG - Intergenic
948519371 2:238525765-238525787 AATTTTAAAGACAGGAAGAAAGG + Intergenic
948873604 2:240816120-240816142 AAGAACAAAGACAGGGACAAGGG + Intronic
1168957573 20:1845231-1845253 ATGTATAAACACAAAGACAAGGG - Intergenic
1173415756 20:42854361-42854383 AAGTTTGAACACCTTGACAAAGG + Intronic
1175704604 20:61167438-61167460 AAAATTAAACACAGGCAAAATGG - Intergenic
1176609811 21:8870435-8870457 AATGTTAAACACAGACACAAGGG - Intergenic
1178625897 21:34218230-34218252 ATGTTTTACCATAGGGACAATGG - Intergenic
1179938594 21:44622638-44622660 AAGTTCAAACACACACACAAAGG - Intronic
1180757617 22:18173602-18173624 AAGTTTAAACACAGGGACAAGGG + Intronic
1181074157 22:20363843-20363865 AAGTTTAAACACAGGGACAAGGG - Intronic
1181729279 22:24832914-24832936 AAATTTAGACACAGCTACAAAGG - Intronic
1182986801 22:34726390-34726412 GAGTTTAAACAAAAGGACACTGG + Intergenic
1183180048 22:36253819-36253841 AAGTCTGAACAGAGGGACAGAGG - Exonic
1184365205 22:44046761-44046783 AACTTTGAACACAGAGACACTGG - Intronic
949712434 3:6887114-6887136 CAGTTTAAACAGTGGGAGAAAGG - Intronic
950836849 3:15928517-15928539 AAGTGTAAAAACAGGTAAAATGG + Intergenic
950910484 3:16584500-16584522 ATTTTTAAACAAAGGTACAAGGG + Intergenic
952823836 3:37508205-37508227 AATTTTAAAAACAGGAATAAAGG + Intronic
953143034 3:40247242-40247264 ACATTTAAACACATGGAAAATGG - Intronic
953220939 3:40971043-40971065 AAGTGTCCCCACAGGGACAATGG - Intergenic
953677761 3:45016530-45016552 AAGTTTGCACAAAGGGATAAGGG + Intronic
953966033 3:47308133-47308155 AAGCTTTAACACAGTCACAAAGG - Intronic
954189246 3:48944769-48944791 AGGTTAAAGCACAGAGACAAAGG - Intronic
955564090 3:60225437-60225459 AAGTTTAGAAACAGGGCTAAAGG + Intronic
956760308 3:72437151-72437173 ATGTTTAAACTCAGGGAAACGGG - Intronic
960350273 3:116584299-116584321 AAGTTTAAACACAGTTTAAAGGG + Intronic
962293057 3:134153804-134153826 AAGTTCAAATCCAGGGAAAAAGG + Intronic
962980797 3:140487713-140487735 CAGCCTAAACAGAGGGACAAGGG - Intronic
964211629 3:154234703-154234725 AAATTCAAAGACTGGGACAAGGG - Intronic
964808866 3:160641002-160641024 GGGTATAAATACAGGGACAATGG + Intergenic
964879766 3:161410340-161410362 AAGTTGAGACCCTGGGACAAAGG - Intergenic
965293646 3:166916293-166916315 ACGCTTAAACACAGAGACCAGGG - Intergenic
967344008 3:188433273-188433295 TATTTTTCACACAGGGACAAAGG - Intronic
967350113 3:188505354-188505376 AAATTTAGAGACAGGGAGAAAGG - Intronic
967616937 3:191581497-191581519 AAGTTTCTTCACAGTGACAATGG + Intergenic
967746284 3:193059575-193059597 CAGTTTAAAGACAGAGAGAAAGG - Intergenic
968239210 3:197060684-197060706 AAGCTTAAACTCACTGACAAAGG + Intronic
1202736490 3_GL000221v1_random:5213-5235 AATGTTAAACACAGACACAAGGG - Intergenic
969068075 4:4505929-4505951 AAATTAAAAAACAGGCACAAAGG - Intronic
970762302 4:19505505-19505527 GAGTATAAACACAGGCACAAGGG + Intergenic
971745879 4:30579807-30579829 AAGTCTAAACAAAGGGAGAAAGG + Intergenic
971835273 4:31755272-31755294 CAGTTTAAACACACAGAAAAAGG + Intergenic
974667543 4:64984449-64984471 ATGATGAAACACAGGAACAATGG + Intergenic
975354791 4:73389184-73389206 AAGTGTAAACATAAGGTCAATGG + Intergenic
975660537 4:76684421-76684443 AGGTTTAAACAGAGGCAAAAAGG - Intronic
975753650 4:77550494-77550516 AAGTTTAAAAAAAGGGAAATTGG - Intronic
976310940 4:83612628-83612650 TATTTTAAAAAAAGGGACAAAGG - Intergenic
976968817 4:91079138-91079160 AAGTTGAAACAAAGGAAAAAAGG + Intronic
979243675 4:118473483-118473505 CAGTTCAAAGCCAGGGACAAAGG - Intergenic
979379323 4:119990358-119990380 AATCCTAAACACATGGACAAAGG + Intergenic
980181038 4:129400949-129400971 AAGTTTAAACACTGTTACTAAGG + Intergenic
980673272 4:136038771-136038793 AAGTTAAAACACATGGTTAATGG - Intergenic
982576151 4:157112612-157112634 AGGCTTAAACACAGGAACAGTGG + Intronic
983127447 4:163971720-163971742 TATTTAAAACACAGGAACAAAGG - Intronic
986068333 5:4257660-4257682 AAGCGTAAACACAGGGAAAGCGG + Intergenic
987629907 5:20456697-20456719 AATTTTAAACACATGCAAAATGG + Intronic
988822074 5:34897034-34897056 AGGTTTAAACAAAGTGACACAGG + Intronic
990050301 5:51491646-51491668 AAGTTTCAACACATAGACATAGG - Intergenic
990204823 5:53417263-53417285 AAGTGGAAGCACAGGGACAAAGG + Intergenic
990996613 5:61738299-61738321 AAGTTTAAAGCCAGAGACAATGG + Intronic
993435943 5:87894242-87894264 AAATTTAAACAGAGGAACAGAGG - Intergenic
993829956 5:92743217-92743239 ATGTTTCAATACAGAGACAAAGG - Intergenic
993958381 5:94265377-94265399 AAATTTTAACACAGTGAAAAAGG - Intronic
995487537 5:112654301-112654323 AAGTTTTAAAACAGATACAAGGG + Intergenic
996066069 5:119080650-119080672 ATGATTAAATACAGGGACAGAGG - Intronic
996233720 5:121100358-121100380 AATTTTTGACAAAGGGACAAAGG + Intergenic
996986722 5:129576218-129576240 AGATTCAATCACAGGGACAATGG - Intronic
998057742 5:139093371-139093393 AAGTTCTAACACAGGGAGACAGG + Intronic
998974577 5:147630477-147630499 AAGTTTAAACACCAGGACAATGG + Intronic
1001401244 5:171447833-171447855 AAGTTTAATTTCAGTGACAAGGG - Intronic
1002832763 6:838344-838366 AAGTCAAAACACTGAGACAATGG + Intergenic
1005055047 6:21721174-21721196 CAGCTTAAACAATGGGACAAAGG + Intergenic
1005127613 6:22466283-22466305 AAGGATAAACAAAGGAACAAGGG - Intergenic
1008453011 6:51674649-51674671 AAGTCTAAACACAGGCCAAAAGG - Intronic
1010664461 6:78612185-78612207 ATGTGTAAACAATGGGACAATGG + Intergenic
1012680086 6:102169259-102169281 CAGTGAAAACACAGGGACACAGG + Intergenic
1015375035 6:132500765-132500787 AATTTTAAACATAGGAATAATGG - Intronic
1017665105 6:156712472-156712494 AAGATTGAAGACAGGTACAAAGG + Intergenic
1022310612 7:29193660-29193682 AGGTTTAAATACAGGGGGAAGGG + Intronic
1022361650 7:29665563-29665585 AAGTATAAACACGGAGAAAATGG + Intergenic
1022699739 7:32748158-32748180 AAGTATAAACACGGAGAAAATGG - Intergenic
1023506684 7:40906784-40906806 AACTTTAAAAACTGGGAGAAAGG + Intergenic
1024261897 7:47579588-47579610 AAGTTCATACACAGGGACACAGG + Intronic
1024276303 7:47679796-47679818 AAATCTAAACACAGTGAAAAGGG - Intergenic
1024599998 7:50972045-50972067 CAGTTTAAACACATGGACGTTGG - Intergenic
1024631679 7:51253881-51253903 AAGTTGAAAAACAGAAACAAAGG - Intronic
1026079197 7:67202280-67202302 GAGCTTAAAGACAGGGCCAATGG - Intronic
1026360055 7:69595684-69595706 CAGTTAAAACACAGGCAAAATGG + Intergenic
1027418898 7:78000947-78000969 AAATTTCAACAAAGGTACAATGG - Intergenic
1027529403 7:79311920-79311942 AATTTTAAAAATAGGGACAAAGG - Intronic
1027757653 7:82235340-82235362 AAGTATTAACACAGGGCCACAGG - Intronic
1028047262 7:86138036-86138058 AAGTTTAAACAAATGGCCTATGG + Intergenic
1028725456 7:94082116-94082138 AATTCTAAAGACAGGGACCAAGG + Intergenic
1029114167 7:98228931-98228953 GAGTGTGAACACTGGGACAATGG + Intronic
1029831646 7:103266609-103266631 AAGTATAAACACGGAGAAAATGG - Intergenic
1030322072 7:108179585-108179607 GAATTTGGACACAGGGACAAGGG - Intronic
1030869590 7:114738637-114738659 AAATTTATGCACAGGGAAAAAGG - Intergenic
1030987592 7:116260889-116260911 AAGAATAACCACAGGGAAAATGG + Intergenic
1031451137 7:121921457-121921479 AAGTTTGAACATAAGGATAATGG - Intronic
1031825922 7:126565116-126565138 AAGTTGAAAGATCGGGACAAAGG + Intronic
1035531924 8:359464-359486 AAGATTAAACACAAGGATAACGG - Intergenic
1036278062 8:7373756-7373778 GAATTTAAACACAGGAACCAGGG + Intronic
1036343461 8:7938136-7938158 GAATTTAAACACAGGAACCAGGG - Intronic
1036838802 8:12098900-12098922 GAATTTAAACACAGGAACCAGGG - Intergenic
1036860590 8:12345143-12345165 GAATTTAAACACAGGAACCAGGG - Intergenic
1039741563 8:40387759-40387781 AAGTTCAAATACTGGGAAAATGG - Intergenic
1039788329 8:40853759-40853781 AAGCTTCAACACAGTGAAAAAGG + Intronic
1040719182 8:50296559-50296581 AAATGAAAACACAGGGACACAGG + Intronic
1045725883 8:105173042-105173064 AATTTTAATAACAGGCACAATGG + Intronic
1045755458 8:105535861-105535883 AATTTTAAAAACAGTCACAAAGG - Intronic
1045774408 8:105785394-105785416 AAGTCCAAACACAGGGTCAGTGG - Intronic
1045934765 8:107666396-107666418 AATTTTAAACAAAAGGAAAATGG - Intergenic
1046112522 8:109743021-109743043 AAATTTAAAGACAGGGATAGAGG - Intergenic
1046640705 8:116727320-116727342 AAGTGCAAACAAAGGGAAAAAGG + Intronic
1050971252 9:11878415-11878437 ATGTATAAAAACAGGGCCAAGGG + Intergenic
1052211161 9:25905115-25905137 TAGGTTAAATACAGGGAGAAAGG + Intergenic
1053673952 9:40402469-40402491 AAGCATAAAAACAGGGAAAAAGG + Intergenic
1053923755 9:43028836-43028858 AAGCATAAAAACAGGGAAAAAGG + Intergenic
1054385055 9:64542535-64542557 AAGCATAAAAACAGGGAAAAAGG + Intergenic
1054510674 9:65973821-65973843 AAGCATAAAAACAGGGAAAAAGG - Intergenic
1055104196 9:72495581-72495603 AATCTAAAACAGAGGGACAATGG - Intergenic
1056038131 9:82630941-82630963 AATTTTAAAAACTAGGACAATGG + Intergenic
1057667055 9:97054317-97054339 AAGGTGAAACACAGGGGAAAAGG + Intergenic
1057855732 9:98599514-98599536 AAGTTTCAACACAGGGTGAGGGG + Intronic
1058087329 9:100762541-100762563 AAGATTATACACAGGAGCAAAGG + Intergenic
1058326951 9:103710473-103710495 TAGTTTACACACATGGACACAGG + Intergenic
1059149445 9:111936083-111936105 AGGTTTCAACACAGGAACTACGG - Intergenic
1061830456 9:133289894-133289916 AGGTTTAAACAAAGTGAAAAGGG - Intergenic
1061887210 9:133597721-133597743 AAATCTAAACACAGAGCCAAGGG + Intergenic
1203705222 Un_KI270742v1:35652-35674 AATGTTAAACACAGACACAAGGG - Intergenic
1185788179 X:2907939-2907961 CAGTTTCAACACAGGGGAAAGGG - Intronic
1187555953 X:20351312-20351334 AAATATAAAAGCAGGGACAATGG - Intergenic
1189688078 X:43586676-43586698 TACTTCAAACACAGGGACAAGGG + Intergenic
1191139417 X:57100548-57100570 AAATGTGAACACATGGACAAAGG + Intergenic
1193737974 X:85183425-85183447 AAGTATAAACACAGATACATAGG - Intergenic
1194920948 X:99762871-99762893 AAGTTTATTCAAAGGGAAAATGG + Intergenic
1195958084 X:110355412-110355434 AAATTTAAAAACATGGGCAAAGG + Intronic
1195975031 X:110517396-110517418 AAGTTAAAAGAAAGGGAGAAAGG - Intergenic
1196358043 X:114817983-114818005 AAGATTGAACACTGTGACAATGG + Intronic
1197254137 X:124244813-124244835 AAGTATAAACACTGGAAGAAGGG - Intronic
1197406267 X:126055202-126055224 ATGTGTAAAGACAGAGACAAGGG - Intergenic
1197776784 X:130123380-130123402 AAGAGGAAACACAGGGAAAAGGG + Intergenic
1199049322 X:143218378-143218400 AAGTTAAAATTCAGGGAGAATGG - Intergenic
1202031536 Y:20579795-20579817 AAATGGAAACACAGGGACAACGG - Intronic