ID: 1181076269

View in Genome Browser
Species Human (GRCh38)
Location 22:20379393-20379415
Sequence TCACACATACTGGTGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181076269_1181076274 1 Left 1181076269 22:20379393-20379415 CCCTCCACCACCAGTATGTGTGA No data
Right 1181076274 22:20379417-20379439 TAGTTTATGTTTTATAAAGCTGG 0: 1
1: 0
2: 4
3: 67
4: 663
1181076269_1181076277 28 Left 1181076269 22:20379393-20379415 CCCTCCACCACCAGTATGTGTGA No data
Right 1181076277 22:20379444-20379466 ATACAATATGATTTCTTGGCTGG 0: 1
1: 0
2: 1
3: 22
4: 289
1181076269_1181076275 2 Left 1181076269 22:20379393-20379415 CCCTCCACCACCAGTATGTGTGA No data
Right 1181076275 22:20379418-20379440 AGTTTATGTTTTATAAAGCTGGG 0: 1
1: 1
2: 1
3: 60
4: 720
1181076269_1181076276 24 Left 1181076269 22:20379393-20379415 CCCTCCACCACCAGTATGTGTGA No data
Right 1181076276 22:20379440-20379462 GTTCATACAATATGATTTCTTGG 0: 1
1: 0
2: 0
3: 16
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181076269 Original CRISPR TCACACATACTGGTGGTGGA GGG (reversed) Intronic
No off target data available for this crispr