ID: 1181080199

View in Genome Browser
Species Human (GRCh38)
Location 22:20409089-20409111
Sequence CACGCCCAGCTAAATTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181080193_1181080199 17 Left 1181080193 22:20409049-20409071 CCTGAGTGGTTGGGACTTTGGGA No data
Right 1181080199 22:20409089-20409111 CACGCCCAGCTAAATTTTTGGGG No data
1181080186_1181080199 29 Left 1181080186 22:20409037-20409059 CCACCTCAACCTCCTGAGTGGTT No data
Right 1181080199 22:20409089-20409111 CACGCCCAGCTAAATTTTTGGGG No data
1181080188_1181080199 26 Left 1181080188 22:20409040-20409062 CCTCAACCTCCTGAGTGGTTGGG 0: 3
1: 187
2: 7022
3: 111130
4: 216102
Right 1181080199 22:20409089-20409111 CACGCCCAGCTAAATTTTTGGGG No data
1181080185_1181080199 30 Left 1181080185 22:20409036-20409058 CCCACCTCAACCTCCTGAGTGGT No data
Right 1181080199 22:20409089-20409111 CACGCCCAGCTAAATTTTTGGGG No data
1181080190_1181080199 20 Left 1181080190 22:20409046-20409068 CCTCCTGAGTGGTTGGGACTTTG No data
Right 1181080199 22:20409089-20409111 CACGCCCAGCTAAATTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181080199 Original CRISPR CACGCCCAGCTAAATTTTTG GGG Intergenic
No off target data available for this crispr