ID: 1181080616

View in Genome Browser
Species Human (GRCh38)
Location 22:20412394-20412416
Sequence GGTCATGCCCAAGTATGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181080616_1181080618 1 Left 1181080616 22:20412394-20412416 CCACGGCATACTTGGGCATGACC No data
Right 1181080618 22:20412418-20412440 GCAGCCTTTTGTTGCCATCCAGG No data
1181080616_1181080622 20 Left 1181080616 22:20412394-20412416 CCACGGCATACTTGGGCATGACC No data
Right 1181080622 22:20412437-20412459 CAGGTTCGTGTTCATTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181080616 Original CRISPR GGTCATGCCCAAGTATGCCG TGG (reversed) Intergenic
No off target data available for this crispr