ID: 1181081315

View in Genome Browser
Species Human (GRCh38)
Location 22:20417703-20417725
Sequence TGGGGCCTGCTACGGGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181081315_1181081326 17 Left 1181081315 22:20417703-20417725 CCACATCCCCGTAGCAGGCCCCA No data
Right 1181081326 22:20417743-20417765 AACTGCGCCGAAGTTCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181081315 Original CRISPR TGGGGCCTGCTACGGGGATG TGG (reversed) Intergenic
No off target data available for this crispr