ID: 1181082048

View in Genome Browser
Species Human (GRCh38)
Location 22:20422674-20422696
Sequence TCTGCTTGTAACCACCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181082045_1181082048 -1 Left 1181082045 22:20422652-20422674 CCTCTGTGTGCTGTGGCCTGCGT No data
Right 1181082048 22:20422674-20422696 TCTGCTTGTAACCACCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181082048 Original CRISPR TCTGCTTGTAACCACCAGGC TGG Intergenic
No off target data available for this crispr