ID: 1181082723

View in Genome Browser
Species Human (GRCh38)
Location 22:20425325-20425347
Sequence GGGCGGCGCTGCGAAGCTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181082712_1181082723 10 Left 1181082712 22:20425292-20425314 CCGTGCCCGGTAGCGTGGGAGGT 0: 1
1: 0
2: 0
3: 2
4: 77
Right 1181082723 22:20425325-20425347 GGGCGGCGCTGCGAAGCTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 85
1181082708_1181082723 14 Left 1181082708 22:20425288-20425310 CCGCCCGTGCCCGGTAGCGTGGG 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1181082723 22:20425325-20425347 GGGCGGCGCTGCGAAGCTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 85
1181082704_1181082723 29 Left 1181082704 22:20425273-20425295 CCGGCCAATAGGAGGCCGCCCGT 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1181082723 22:20425325-20425347 GGGCGGCGCTGCGAAGCTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 85
1181082705_1181082723 25 Left 1181082705 22:20425277-20425299 CCAATAGGAGGCCGCCCGTGCCC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1181082723 22:20425325-20425347 GGGCGGCGCTGCGAAGCTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 85
1181082710_1181082723 11 Left 1181082710 22:20425291-20425313 CCCGTGCCCGGTAGCGTGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1181082723 22:20425325-20425347 GGGCGGCGCTGCGAAGCTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 85
1181082716_1181082723 4 Left 1181082716 22:20425298-20425320 CCGGTAGCGTGGGAGGTGTGGGG 0: 1
1: 0
2: 1
3: 17
4: 194
Right 1181082723 22:20425325-20425347 GGGCGGCGCTGCGAAGCTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 85
1181082714_1181082723 5 Left 1181082714 22:20425297-20425319 CCCGGTAGCGTGGGAGGTGTGGG 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1181082723 22:20425325-20425347 GGGCGGCGCTGCGAAGCTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 85
1181082703_1181082723 30 Left 1181082703 22:20425272-20425294 CCCGGCCAATAGGAGGCCGCCCG 0: 1
1: 1
2: 0
3: 5
4: 66
Right 1181082723 22:20425325-20425347 GGGCGGCGCTGCGAAGCTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181082723 Original CRISPR GGGCGGCGCTGCGAAGCTGA GGG Exonic
900951085 1:5858615-5858637 GGGCGGCGCTGAGGGTCTGAGGG - Intergenic
906637264 1:47417532-47417554 GGGGGGCGCCGCAAAGCTGGGGG - Exonic
915469057 1:156114894-156114916 GGGCAGCGCTGCCAACCTGCCGG + Exonic
920865338 1:209747769-209747791 GGGTGGCGCTGCCACCCTGACGG - Intergenic
922518271 1:226223925-226223947 TTGCGGCGCTGCGACGCCGACGG - Exonic
1067227255 10:44384346-44384368 GGGCTGCGCGGCGCAGCTGTCGG - Intronic
1069621472 10:69840189-69840211 GGGCTGGGCTGTGAAGCTGCTGG + Intronic
1074047631 10:109852923-109852945 GGGCTGAGCTGCGAAGTGGAAGG - Intergenic
1075006668 10:118835625-118835647 GGGCGGGACTGCCAAGCTGATGG - Intergenic
1075023712 10:118968704-118968726 AGGTGGAGCTGCGAGGCTGAGGG - Intergenic
1076139063 10:128065103-128065125 GGGCGGGGCTGCGGGGCTGTGGG - Intronic
1076238270 10:128882774-128882796 GGGCTGCACTGGGAAGGTGATGG + Intergenic
1076698308 10:132257529-132257551 GGGCGGAGCTGCGAAGGAGTGGG + Intronic
1077052933 11:575907-575929 GGGCGGGGCTGCGAGGGTGGGGG + Intergenic
1077052939 11:575927-575949 GGGCGGGGCTGCGGAGCAGCGGG + Intergenic
1079213432 11:18484453-18484475 AGGCTTCGCTGCTAAGCTGAAGG + Intronic
1083901096 11:65643935-65643957 GGGCGGGGATGCCAGGCTGAAGG + Intronic
1083922215 11:65787120-65787142 GGGCGGCGCGGGGAAGCGGCAGG - Exonic
1091229315 11:133977479-133977501 GGGAAGCGCTGCTCAGCTGAGGG - Intergenic
1097679008 12:62632004-62632026 TGGCGGCGCTGCTGAGATGATGG + Intergenic
1100679791 12:96907099-96907121 GGGCGGCGCTGGGCAGCCGCGGG - Intergenic
1103412245 12:120720599-120720621 GGGTGATGCTGCCAAGCTGAAGG + Exonic
1103918730 12:124388790-124388812 GGTCGGCTCTGCGAGGCTGCTGG + Intronic
1104695529 12:130860632-130860654 TGGCAGCCCTGGGAAGCTGATGG + Intergenic
1104961543 12:132490481-132490503 CGGCGGCGCCGCGTAGCCGAGGG + Exonic
1105409560 13:20160796-20160818 CGGCGGCGCAGCGGAGCTGCCGG - Intronic
1105578854 13:21675404-21675426 GGGCGGGGCTGGGAAGGCGAGGG - Intronic
1107276595 13:38686962-38686984 GGGAGGAGGTGCGGAGCTGAGGG - Intergenic
1108689133 13:52846657-52846679 GGGCGCTGCTGGAAAGCTGAGGG + Exonic
1109037685 13:57286643-57286665 GCGCGGCGCTGTGAAGCAGGGGG + Intergenic
1117068366 14:52033281-52033303 GGGCTGTGCAGTGAAGCTGAAGG - Intronic
1117912680 14:60649618-60649640 GGGCGAGGCTGCGGAGCTGGGGG + Intronic
1126034904 15:44536975-44536997 CGGTGGCGCTGCGGGGCTGAGGG - Intergenic
1127224986 15:56918934-56918956 GGGCGGCGCGGCGGGGCTGGGGG + Intronic
1129465494 15:75722221-75722243 GGGCAGCCCTGAGGAGCTGAAGG + Intergenic
1131513198 15:93060939-93060961 AGGTGGCGCAGGGAAGCTGAGGG - Intronic
1135234340 16:20741636-20741658 GCTCGGCGCTGCGACGCTGGCGG - Exonic
1138023383 16:53503740-53503762 GGGCGGCGCTGCGAGGCCCGAGG + Intronic
1141148033 16:81545628-81545650 GGGCGGACCTGCGATGCTCACGG + Intronic
1141177524 16:81730630-81730652 GGGAGGCTCTGTGAGGCTGAGGG + Intergenic
1142600172 17:1050018-1050040 GGGCGCCGGGGCGAGGCTGAGGG - Intronic
1146398832 17:32488015-32488037 GGGCGTCCCTGCGGAGGTGACGG - Exonic
1147258361 17:39195252-39195274 GGGAGGCGCGGAGAAGCTGGAGG + Intronic
1148124917 17:45231572-45231594 GGGTGGCTCGGCGAATCTGAGGG + Intronic
1148758092 17:49985143-49985165 GGGAGGGGCTGTGAAGCTGAGGG - Intergenic
1150211872 17:63446263-63446285 GCGCGGCGCGGGGAGGCTGAAGG - Intronic
1152405636 17:80096494-80096516 GGGCCGGGCTAGGAAGCTGAGGG - Intronic
1161025568 19:2035143-2035165 GGGCGGAGCTTGGAATCTGAAGG - Intergenic
1161051607 19:2166843-2166865 GGGCGCCGCAGGGAAGCTGGGGG - Intronic
1163632920 19:18426265-18426287 GGGCGGCGCAGCTGAGCTGGAGG + Intronic
1165160544 19:33813199-33813221 GCGCCAGGCTGCGAAGCTGAGGG - Exonic
1168682520 19:58326563-58326585 GGGCGGCTGTGTGAGGCTGAGGG - Intergenic
925908065 2:8551431-8551453 GGGCCGGGCTGTGAAGCTGAAGG - Intergenic
929553496 2:42909034-42909056 GGGAGGCCCTGCAAGGCTGAGGG + Intergenic
929933430 2:46276197-46276219 GGGCGGCCCTGCCAGGCTGCCGG - Intergenic
932722478 2:74147983-74148005 GGGCGGGGCCGGGAGGCTGACGG - Exonic
938086830 2:128407336-128407358 GGGAGGCACTGGGAAGCAGAGGG + Intergenic
943069573 2:183124683-183124705 AGGTGGCGCCGGGAAGCTGAGGG + Intronic
947375890 2:229494565-229494587 GGGCTGCCCTGCAAAGCTGTGGG - Intronic
1181082723 22:20425325-20425347 GGGCGGCGCTGCGAAGCTGAGGG + Exonic
1184153124 22:42649702-42649724 GGGCCGCGCTGAGCAGCTGCAGG - Intergenic
952825363 3:37520290-37520312 GGGAGGCGCTGCGAAGAGGAGGG + Intronic
953947811 3:47164156-47164178 GGCCGGGCCTGCGAAGCTGAGGG - Intergenic
959162940 3:102741494-102741516 AGGTGGCGCTGCAAAACTGATGG + Intergenic
961645577 3:128391103-128391125 GGGCGGGGCTGCAGAGGTGAGGG - Intronic
963116936 3:141738320-141738342 TGGCGGCGCCGCGGAGCCGACGG - Exonic
968250549 3:197207088-197207110 TGGCGGAGCTGGGAAGCAGACGG + Intronic
972449435 4:39182155-39182177 AGGGGGCGCCGAGAAGCTGAAGG - Intergenic
987389890 5:17366058-17366080 GGGCGAGGATGCCAAGCTGAGGG + Intergenic
1003528472 6:6917980-6918002 GGGCGGCGGGGAGAAGCAGAGGG + Intergenic
1008413661 6:51214081-51214103 GGGCAGAGCTGCCAATCTGAAGG - Intergenic
1008576901 6:52869350-52869372 ACGCGGCGCTGTGAGGCTGAAGG + Intronic
1014097995 6:117481519-117481541 GCGCGGTGGTGCGAAGGTGAGGG + Intronic
1018330924 6:162727301-162727323 CGGCGGCGGGGCGAAGGTGAGGG + Intronic
1018417690 6:163615339-163615361 GGGTGGGGCTGAGCAGCTGAAGG + Intergenic
1018608848 6:165626756-165626778 GGGCGGCGGGGGGAAGTTGAAGG + Intronic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1032570989 7:132996732-132996754 AGGCAGCGGTGCGATGCTGAGGG + Intronic
1036803208 8:11808368-11808390 GGGCGGGGCTGCGGGGCTGCGGG + Intronic
1040810667 8:51449037-51449059 GAGTGGCTCTGTGAAGCTGACGG - Exonic
1049574854 8:143385269-143385291 GGGCGAGGCTGCGAGGCTGGGGG + Intergenic
1049587870 8:143440337-143440359 GTGGGGCGCTGGGATGCTGAAGG + Exonic
1049614446 8:143569989-143570011 CGTCCGCGCTGCGAAGCCGAGGG + Exonic
1051616610 9:19012855-19012877 GGGAGGCGCTGCGGAGCTCAGGG + Intronic
1053482054 9:38423429-38423451 GGGCTGAGCTGGGATGCTGAGGG - Intronic
1060897190 9:127225361-127225383 GGGCGGCGCTGCGGCGCAGGGGG + Intronic
1194275018 X:91867955-91867977 AGGCAGGGCTGTGAAGCTGAAGG - Intronic
1196212493 X:113011244-113011266 AGGCTGCTCTGCGAAGCTCAAGG - Intergenic
1200592258 Y:5089357-5089379 AGGCAGGGCTGGGAAGCTGAAGG - Intronic