ID: 1181085158

View in Genome Browser
Species Human (GRCh38)
Location 22:20436480-20436502
Sequence GAGCCCCGCCTCCGGGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181085158_1181085171 6 Left 1181085158 22:20436480-20436502 CCCCCGCCCCGGAGGCGGGGCTC No data
Right 1181085171 22:20436509-20436531 GGGAGGGGTCTGCGCGCCTCCGG No data
1181085158_1181085170 -9 Left 1181085158 22:20436480-20436502 CCCCCGCCCCGGAGGCGGGGCTC No data
Right 1181085170 22:20436494-20436516 GCGGGGCTCGCAGCGGGGAGGGG No data
1181085158_1181085169 -10 Left 1181085158 22:20436480-20436502 CCCCCGCCCCGGAGGCGGGGCTC No data
Right 1181085169 22:20436493-20436515 GGCGGGGCTCGCAGCGGGGAGGG No data
1181085158_1181085172 18 Left 1181085158 22:20436480-20436502 CCCCCGCCCCGGAGGCGGGGCTC No data
Right 1181085172 22:20436521-20436543 CGCGCCTCCGGACCAGAGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181085158 Original CRISPR GAGCCCCGCCTCCGGGGCGG GGG (reversed) Intronic