ID: 1181085317

View in Genome Browser
Species Human (GRCh38)
Location 22:20437018-20437040
Sequence GCTCGAAGTGGACCAGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181085317_1181085323 2 Left 1181085317 22:20437018-20437040 CCCGCTTCTGGTCCACTTCGAGC 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1181085323 22:20437043-20437065 CGGCTCCTCGACGCTCGCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 43
1181085317_1181085322 1 Left 1181085317 22:20437018-20437040 CCCGCTTCTGGTCCACTTCGAGC 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1181085322 22:20437042-20437064 CCGGCTCCTCGACGCTCGCCTGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181085317 Original CRISPR GCTCGAAGTGGACCAGAAGC GGG (reversed) Intronic
902761136 1:18581459-18581481 GCTGGAGGTGGCCCAGGAGCAGG - Intergenic
903063302 1:20684819-20684841 GCCCGTTGTGGACCAGCAGCAGG - Exonic
909602594 1:77476506-77476528 GCTAAAAGTGGAGCTGAAGCTGG - Intronic
915167022 1:153953640-153953662 GCTGGCAGTGGACAAGAAGGTGG + Intronic
915445493 1:155972275-155972297 GCTCTAGGTGGGCCAGCAGCGGG + Intronic
917639686 1:176970953-176970975 GCTGAATGTGGGCCAGAAGCAGG - Intronic
918715771 1:187784337-187784359 GCAAGAAGAGGACCAGAAGAGGG + Intergenic
922150658 1:223000798-223000820 TCTCAAAGTAGAGCAGAAGCTGG - Intronic
1067723598 10:48749619-48749641 GGTGAAAGTGGAGCAGAAGCAGG + Intronic
1074099937 10:110346887-110346909 GCTCAAATTGTACCAGAAGCTGG - Intergenic
1076750481 10:132539641-132539663 GCTCCAAGTGGCCCAGATGGAGG + Intronic
1081628309 11:44669122-44669144 GCTGGATGGGGACCAGAAACAGG + Intergenic
1084492090 11:69484406-69484428 TCTGGAGGTGGACAAGAAGCAGG - Intergenic
1088229979 11:107663625-107663647 TGTGGAAGTGGACCAGCAGCCGG + Intronic
1090865601 11:130698038-130698060 GCCCGAAGCAGAGCAGAAGCAGG - Intronic
1098139772 12:67439633-67439655 GCTCCACGTGGGCCAGAACCAGG - Intergenic
1103561593 12:121795736-121795758 GGAAGAAGAGGACCAGAAGCTGG + Intronic
1103985007 12:124761098-124761120 GCTCGATGTGGACTTGAACCTGG - Intergenic
1114362540 14:21990928-21990950 GCTCTAAGTGGCACAGTAGCTGG + Intergenic
1118024369 14:61753893-61753915 GCTGGAAGTGCAGCAGAAGATGG - Intergenic
1118383885 14:65239441-65239463 GCACAAAGGGGATCAGAAGCAGG + Intergenic
1118425126 14:65652224-65652246 GCCTTCAGTGGACCAGAAGCTGG + Intronic
1119854379 14:77888290-77888312 GCTCGAAGTGGAGATGAGGCTGG + Intronic
1127532899 15:59862573-59862595 GCTTGAAGGAGAACAGAAGCAGG + Intergenic
1128138633 15:65283099-65283121 TCTCTAAGTGGACTAGAATCTGG - Intronic
1128516232 15:68343822-68343844 GCTTGAAGTGGACCTGAGGAAGG + Intronic
1129617973 15:77114812-77114834 GCTGGTAGTGGACAAGTAGCAGG + Exonic
1131605651 15:93900456-93900478 GCTCTCAGTAGACCTGAAGCAGG + Intergenic
1135757727 16:25111915-25111937 GCTCGAGGTGGAACAGCAGGAGG - Exonic
1138502525 16:57456605-57456627 GCTAGAAGAGGAGCAGAAGCTGG + Exonic
1140126121 16:72120281-72120303 GGTCTGAGTGGACCAGGAGCTGG + Intronic
1141081990 16:81060849-81060871 GCTGGGAGTGGACATGAAGCAGG + Intronic
1143917339 17:10303456-10303478 GCTTGATGTGGAACAGAAGAGGG - Exonic
1144910007 17:18672866-18672888 GCTCGAAGTGGAGCTGGACCCGG - Intronic
1145870092 17:28266774-28266796 GCTAGAACGGGACCAGAACCAGG + Intergenic
1147577267 17:41610001-41610023 GCTCGAAGAGGACGAGGAGGAGG + Exonic
1148675205 17:49440853-49440875 GCTCCAAGTAGACCAGAGACTGG + Intronic
1151507940 17:74541690-74541712 GCTCCAAGAGGACCAGGAGCAGG + Exonic
1158925971 18:62260886-62260908 GAATGAAATGGACCAGAAGCTGG + Intronic
1159241860 18:65751484-65751506 CCTCAAAGAGGACCACAAGCAGG + Intronic
1160860018 19:1233764-1233786 GCTCGGAGAGGGGCAGAAGCGGG + Intronic
1161031026 19:2057794-2057816 GCTCCAAGTGCACCCAAAGCAGG - Intergenic
1161091052 19:2360226-2360248 CCCCGAAGTGGAGCAGAAGCCGG - Intergenic
1162432124 19:10635427-10635449 GTTGGAAGTGGACAGGAAGCTGG - Exonic
925258278 2:2507920-2507942 GCTCGAAGTGGCCCAGCCACTGG + Intergenic
928418196 2:31114294-31114316 CCACAAAGAGGACCAGAAGCTGG + Intronic
932767495 2:74480804-74480826 TCTGGAAGTGGAGCAGCAGCTGG - Exonic
934975051 2:98796183-98796205 GCCCGCTGTGGACCGGAAGCAGG - Exonic
938697891 2:133851135-133851157 GCTCACAGATGACCAGAAGCAGG + Intergenic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
948975847 2:241463439-241463461 GCGCGAGGTGGAGCAGAGGCTGG + Exonic
1177325413 21:19581668-19581690 TCTAGAAGTGTCCCAGAAGCTGG + Intergenic
1179583603 21:42360877-42360899 GCTCACTGTGGAGCAGAAGCTGG - Intergenic
1181085317 22:20437018-20437040 GCTCGAAGTGGACCAGAAGCGGG - Intronic
953906352 3:46870241-46870263 GCTCCAAGTGGACAAGAAGTGGG + Intronic
954296174 3:49675566-49675588 GCTAGAGGTGCTCCAGAAGCTGG + Intronic
958583375 3:96054148-96054170 GCACAAAGTGAAGCAGAAGCAGG + Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
959500933 3:107105354-107105376 GGACGAAGTGCACCATAAGCAGG - Intergenic
961004728 3:123397255-123397277 GCTTGAAGTGGGGCAGAAGAGGG - Intronic
967940529 3:194762825-194762847 GCTCGGAGTGGTGCAAAAGCCGG - Intergenic
968780924 4:2580754-2580776 ACTAGAAGTGGAGCAGATGCTGG + Intronic
969616435 4:8255614-8255636 TTTCCAAGTGCACCAGAAGCAGG + Intergenic
978508958 4:109494671-109494693 GCTGGAGCTGGAGCAGAAGCAGG - Exonic
990717064 5:58649167-58649189 GCTCCCAGTGGACCAGCAGGTGG - Intronic
991766353 5:69984770-69984792 TCTGGAAGTGGTCCAGAAACAGG - Intergenic
991780965 5:70133383-70133405 TCTGGAAGTGGTCCAGAAACAGG + Intergenic
991845586 5:70859853-70859875 TCTGGAAGTGGTCCAGAAACAGG - Intergenic
991873411 5:71133697-71133719 TCTGGAAGTGGTCCAGAAACAGG + Intergenic
993745014 5:91586459-91586481 GCTCAAAGTGCACCACAGGCAGG + Intergenic
998563486 5:143194099-143194121 TCTCCAAGTGAACCAGAAGAAGG + Intronic
1001648735 5:173300682-173300704 TCTTGAAGGTGACCAGAAGCTGG - Intergenic
1007398983 6:41593072-41593094 GGTCAAAGTGGACCTCAAGCTGG - Intronic
1007914211 6:45545956-45545978 GCTTCAAGTTGACCTGAAGCTGG + Intronic
1013273305 6:108561247-108561269 GCTCGAAGTGGAGCTGGACCCGG + Exonic
1013692930 6:112667343-112667365 GCTCGTAGGGGGCCAGGAGCAGG + Intergenic
1016451561 6:144187921-144187943 GCTCAAAATGGAACAGAACCAGG - Exonic
1019701657 7:2477210-2477232 GCCCGAAGTGGACCTGGAGGGGG + Intergenic
1024435737 7:49352932-49352954 GATCTAAGAGGCCCAGAAGCAGG + Intergenic
1024993380 7:55253548-55253570 GCTCAAGGTTGGCCAGAAGCTGG + Intronic
1031044101 7:116867878-116867900 GCTAGAAATGGACCAGTGGCTGG - Intronic
1034777107 7:153838169-153838191 CCAAGAAGTGGACCAGAACCAGG + Intergenic
1036673397 8:10808662-10808684 ACGCAATGTGGACCAGAAGCTGG + Intronic
1045223802 8:100225243-100225265 GCTTGCAGTGGCACAGAAGCAGG - Exonic
1047678102 8:127224987-127225009 GCTTGAAGAGGAAAAGAAGCAGG + Intergenic
1057880595 9:98790233-98790255 GCTTGGAGTGGCCCAGCAGCTGG - Exonic
1057966634 9:99510438-99510460 GCTCCAAGTAGAACAAAAGCTGG + Intergenic
1059310634 9:113386831-113386853 CCTGGAAGAGGAACAGAAGCAGG - Exonic
1186033049 X:5391038-5391060 GCTTTCAGCGGACCAGAAGCAGG + Intergenic
1187285481 X:17899612-17899634 GCCTGGAGGGGACCAGAAGCTGG + Intergenic
1188465309 X:30472855-30472877 ACAAGAAGTGGATCAGAAGCTGG + Intergenic
1192034109 X:67545236-67545258 GCGCGAAGTGATCCAGAACCCGG + Exonic
1192326221 X:70134414-70134436 GCTGGGAGTGGACCAGAGGGAGG - Intronic
1192947687 X:75983666-75983688 GCTCTAACTGGAGCAGAAGTGGG + Intergenic