ID: 1181090555

View in Genome Browser
Species Human (GRCh38)
Location 22:20469596-20469618
Sequence ACTCCATCTACTCACCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181090555 Original CRISPR ACTCCATCTACTCACCATGC AGG Intronic
904318257 1:29680014-29680036 CCTCCACCCACTCACCCTGCAGG - Intergenic
906098453 1:43240194-43240216 AACTCATCTACTCACCAAGCTGG - Intronic
906337430 1:44945607-44945629 ACACCTGCAACTCACCATGCAGG + Intronic
906545613 1:46617371-46617393 ACTTCATCTCCTCACCAGGGAGG + Intergenic
911097094 1:94063639-94063661 ACTCCCTCGCCTCCCCATGCTGG - Intronic
912104346 1:106252351-106252373 ACTCCCTCTACTCACCTTTCCGG + Intergenic
914666763 1:149839195-149839217 ACTCCTTTTACTCACCAGTCTGG - Intergenic
914669004 1:149854595-149854617 ACTCCTTTTACTCACCAGTCTGG + Intronic
917098631 1:171424419-171424441 ACTCCATTTATTCATCATGTGGG - Intergenic
917650589 1:177073135-177073157 TCTCCATCTACTCCTCATTCTGG + Intronic
921610903 1:217211007-217211029 ACTCCAAGTACTCAAAATGCCGG + Intergenic
924198591 1:241637491-241637513 TCTCCATCTTCACACCCTGCTGG - Intronic
1065223286 10:23518026-23518048 AACTCATCTACTCACCAAGCTGG + Intergenic
1068359851 10:55963110-55963132 ACTCCAGCTACTCAGGAGGCTGG + Intergenic
1070527448 10:77307552-77307574 ACTCCATCTACTGAACATCATGG - Intronic
1081426946 11:42935863-42935885 AATCCATCTAGTCACCAGCCTGG - Intergenic
1085200666 11:74699883-74699905 ACCCCATCTCCTCACCCTGTGGG - Intronic
1085908064 11:80788478-80788500 AATTCATCTACTCATCAAGCTGG + Intergenic
1088037262 11:105333073-105333095 GCTCCATCTTCCAACCATGCAGG - Intergenic
1088500316 11:110476605-110476627 GCACCCTCTACTCACCATGCAGG + Intergenic
1092539541 12:9412384-9412406 ACTGCACCTCTTCACCATGCTGG - Intergenic
1092727318 12:11498813-11498835 ACTGCACCTCTTCACCATGCTGG - Intronic
1094499963 12:31012416-31012438 ACTGCACCTCTTCACCATGCTGG + Intergenic
1096578931 12:52572008-52572030 AGGCCATCTACTCTCCCTGCTGG - Intronic
1101509234 12:105377734-105377756 TCTCCATCTACTCACTCTGCTGG - Intronic
1106317677 13:28609324-28609346 ACTCCCTCTCCTCACCCTGTAGG + Intergenic
1106473511 13:30078179-30078201 ACTCCAGCTTCTCTTCATGCGGG - Intergenic
1106569351 13:30912989-30913011 ACTGCATTTACTCATCATGAGGG + Intronic
1107400619 13:40065491-40065513 ACTCCATCCACCCTCCATGCAGG + Intergenic
1110485477 13:76036550-76036572 GCCCTATCTACTCACCCTGCAGG - Intergenic
1113639376 13:111946293-111946315 GCTCCATGTGCTCACCTTGCAGG - Intergenic
1115697403 14:35913993-35914015 AATTCATCTACTCATCAAGCTGG + Intronic
1125521930 15:40352977-40352999 TCTCCATCTACCCACCATGTAGG + Intronic
1129624148 15:77179279-77179301 ACTTCTTCTCCTTACCATGCAGG - Exonic
1130805607 15:87318295-87318317 ACATCATCTACTCACCAAACTGG + Intergenic
1130950590 15:88583879-88583901 ACTCATTCTACTCACCAAGCTGG - Intergenic
1131634907 15:94222163-94222185 ACTTCAGCTACTGACCATGATGG + Intergenic
1139216978 16:65135617-65135639 CCTCCATCTTTTCCCCATGCTGG + Intergenic
1142667340 17:1470546-1470568 ACTCTATCTTCTTACCATGGTGG + Intronic
1146612304 17:34318674-34318696 ACCTCATCTACTCCCCCTGCAGG - Intergenic
1146858232 17:36273117-36273139 ATCCCAGCTACTCACGATGCAGG - Intronic
1147088552 17:38077180-38077202 ATCCCAGCTACTCACGATGCAGG - Intergenic
1147108658 17:38243343-38243365 ATCCCAGCTACTCACGATGCAGG + Intergenic
1148131702 17:45266294-45266316 ACTCCATCAACTGACAATGAGGG + Intronic
1148420796 17:47544828-47544850 ATCCCAGCTACTCACGATGCAGG - Intronic
1156193904 18:34751364-34751386 CTTCCTTCCACTCACCATGCTGG + Intronic
1157704175 18:49788625-49788647 ACTTCATCCCCTCACCAGGCTGG - Intronic
1157751907 18:50186648-50186670 TCTCCCTCCAGTCACCATGCTGG - Intronic
927693479 2:25224334-25224356 ATTACATCCACTCCCCATGCTGG + Intergenic
928593680 2:32841115-32841137 ACTCCATCCACACACCATGCTGG + Intergenic
930851425 2:55965298-55965320 AACCCATCTACTCACCAAGCTGG - Intergenic
932781377 2:74560662-74560684 ACTCCATGTACTCGCCTTGCAGG - Intronic
933307413 2:80619221-80619243 AGTCAATTTACTCACCATGGAGG - Exonic
936118129 2:109718789-109718811 TCTCAATCTCCTCACCATGTTGG - Intergenic
937819129 2:126288033-126288055 AGTTCATCTACTCTTCATGCTGG - Intergenic
938395063 2:130939503-130939525 ACTCCATCTAATCAACATGAAGG - Intronic
940205297 2:151195550-151195572 ACACCCCCTACACACCATGCAGG - Intergenic
943832130 2:192476614-192476636 ACTCCATCTTTCCCCCATGCTGG - Intergenic
945205198 2:207324131-207324153 ACTCCATCTACTATCATTGCTGG - Intergenic
947273650 2:228367744-228367766 AACCCATCTACTCACCAAGATGG + Intergenic
948100748 2:235370851-235370873 TCTCCACCTGCTCACCATACTGG + Intergenic
1168814293 20:726184-726206 ACTACATCTTCACACAATGCTGG + Intergenic
1169745509 20:8938610-8938632 ACTCCACCTAATCATCATTCTGG - Intronic
1170624981 20:18023463-18023485 CCTCCATCTCCTCACCTTGGAGG - Intronic
1173581965 20:44153523-44153545 CCTCCATCTCCTCCCCATGCTGG - Intronic
1173938475 20:46889589-46889611 TCTCCATCAAAACACCATGCAGG - Intergenic
1175519594 20:59591544-59591566 ACTCCAGCTCCTCATCATGGGGG + Intronic
1181090555 22:20469596-20469618 ACTCCATCTACTCACCATGCAGG + Intronic
1184150013 22:42632254-42632276 ACTCCCTCTCCTGGCCATGCTGG - Intronic
950052771 3:10004759-10004781 TGCCCATCTACCCACCATGCGGG - Intronic
950912069 3:16605188-16605210 TCTCCCTCAACTCACCATGATGG + Intronic
954125165 3:48523916-48523938 CCTGCAGCTACTCACCATTCTGG + Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
955054292 3:55442272-55442294 ACCCCATCTTCTCACAATGCTGG + Intergenic
963775023 3:149429911-149429933 TTTCCATCTACTCTCCATGCAGG + Intergenic
971945866 4:33276479-33276501 ACTCCATGAACTCAACTTGCAGG + Intergenic
976320090 4:83704381-83704403 AACTCATCTACTCGCCATGCTGG - Intergenic
976747459 4:88418388-88418410 ACAACATCTACTCATCAAGCTGG - Intronic
980658148 4:135816600-135816622 AACACATCTACTCACCAAGCTGG + Intergenic
983347511 4:166546100-166546122 ACACCATCTACTCGGCCTGCTGG + Intergenic
983630168 4:169841972-169841994 AACTCATCTACTCACCAAGCTGG - Intergenic
984356815 4:178670638-178670660 ACTCCATCTAACCAACATGCTGG - Intergenic
985608317 5:871207-871229 ACACCTGCTACTCACCAAGCAGG + Intronic
985849788 5:2380618-2380640 ATTCCAGCTACACAACATGCTGG + Intergenic
985891567 5:2719834-2719856 ACTCCAGCTACTCAGGAGGCTGG + Intergenic
988356482 5:30183075-30183097 ACATCATGTACTCACCATTCAGG - Intergenic
991401296 5:66254476-66254498 ACTCCATGTACTCACGAGACAGG - Intergenic
995007590 5:107218984-107219006 ACTTCATCATCTGACCATGCTGG - Intergenic
995514538 5:112940927-112940949 ACTCAATCTACACACCATGAAGG - Intergenic
995871926 5:116752431-116752453 ACTCCATGATCTCACCATTCTGG + Intergenic
998823857 5:146081613-146081635 ACACCATCTGCTCTTCATGCAGG + Exonic
1003112563 6:3261792-3261814 CCTCCATCTACCGTCCATGCAGG + Intronic
1005995727 6:30930233-30930255 AACTCATCTACTCACCAAGCTGG - Intergenic
1007338163 6:41170323-41170345 CCTCCACCTACTCAGCAAGCTGG + Intergenic
1007524233 6:42477545-42477567 ACTCCATCTGCTCCCTTTGCAGG - Intergenic
1007777253 6:44230658-44230680 CCTCCATTTACTCACCAGGCGGG - Exonic
1007852266 6:44814572-44814594 AACTCATCTACTCACCAAGCTGG + Intronic
1008201835 6:48600316-48600338 ATTCCATGTACCCTCCATGCCGG + Intergenic
1010026722 6:71227253-71227275 ACTCCATCTTCTCACCACTGAGG + Intergenic
1011730062 6:90252801-90252823 CCTCCATGTACTGACCATACAGG - Intronic
1012152965 6:95778507-95778529 ACTCCATTTACTCCAAATGCTGG - Intergenic
1015886755 6:137925909-137925931 ACTCCAGCTCCTCTCCATACAGG + Intergenic
1018508121 6:164493581-164493603 TCTCCAGCTACTTACCATGTTGG + Intergenic
1021015491 7:15526127-15526149 ACCCCATCTACTCAGCCCGCCGG - Intronic
1023807731 7:43885805-43885827 GCTGCAGCCACTCACCATGCAGG + Intronic
1026534784 7:71230569-71230591 TCCCCAACCACTCACCATGCCGG - Intronic
1027364228 7:77440614-77440636 ACTGCATCTACTCATCAAGATGG - Intergenic
1027589317 7:80097741-80097763 ACTTCAATTACTCACCATGTAGG + Intergenic
1029107853 7:98193191-98193213 ACTCCCTACACTCACCCTGCTGG - Exonic
1031969534 7:128054119-128054141 ACTCCATCTGACCACCATGCAGG - Intronic
1032537537 7:132677440-132677462 ACTCCATGTCCTCGCCAGGCCGG - Intronic
1037773127 8:21814688-21814710 GCTCCATCAACTCCCCACGCAGG - Intergenic
1038936737 8:32260167-32260189 ACTATATATCCTCACCATGCTGG + Intronic
1039426129 8:37487811-37487833 ACTCCATGTTCACTCCATGCTGG - Intergenic
1040933532 8:52760346-52760368 AATTCATCTACTCGCCAAGCTGG + Intergenic
1043261852 8:78210264-78210286 GTTCCATCTGCTCACTATGCAGG - Intergenic
1044145750 8:88711608-88711630 AGTCCATCTACTAACTGTGCAGG - Intergenic
1044147974 8:88741307-88741329 ACTCCATCTTATCCTCATGCAGG + Intergenic
1046834478 8:118784396-118784418 ACTCAATTCACTAACCATGCTGG - Intergenic
1049229917 8:141476680-141476702 GCTCCATCTACTCCCCACACTGG + Intergenic
1049758355 8:144320734-144320756 GCTCCATCTAATCACCTTCCTGG + Intronic
1051147503 9:14043133-14043155 AGTCCTTCAACTCACCATGGAGG - Intergenic
1060020564 9:120127033-120127055 TCTCCATCTGATCACCATCCAGG - Intergenic
1185986563 X:4841488-4841510 AATGCATCTACTCAGCAAGCTGG - Intergenic
1187935311 X:24330281-24330303 ACTTGATTTACTCACCAGGCAGG - Intergenic
1190208972 X:48429326-48429348 ACTCCAGCTACTCAGGAGGCTGG - Intergenic
1193330675 X:80232529-80232551 ACCCCATCTCTTCACCAGGCAGG - Intergenic
1193942671 X:87695310-87695332 ACTTCATCTTCTCACCTTTCTGG - Intergenic
1195746068 X:108119776-108119798 CCTCCTTCTCCTCACCATGCTGG + Intronic
1196462343 X:115943833-115943855 ACTCCATGTCCTCACCAGTCAGG + Intergenic
1197922669 X:131611670-131611692 AGTCCTTCAATTCACCATGCTGG + Intergenic
1198811789 X:140543384-140543406 TACCCATCTACTCACCATCCTGG - Intergenic
1199208881 X:145182768-145182790 ACTCCATCTACTCTCCCATCAGG - Intergenic