ID: 1181091513

View in Genome Browser
Species Human (GRCh38)
Location 22:20476206-20476228
Sequence GGGAAAGTGCCCCGAGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181091513_1181091520 11 Left 1181091513 22:20476206-20476228 CCAAGCCCTCGGGGCACTTTCCC No data
Right 1181091520 22:20476240-20476262 AGTGGTCTGTCTGGCTCTCCTGG No data
1181091513_1181091521 21 Left 1181091513 22:20476206-20476228 CCAAGCCCTCGGGGCACTTTCCC No data
Right 1181091521 22:20476250-20476272 CTGGCTCTCCTGGACTTTCCAGG No data
1181091513_1181091519 2 Left 1181091513 22:20476206-20476228 CCAAGCCCTCGGGGCACTTTCCC No data
Right 1181091519 22:20476231-20476253 GCTCTTTACAGTGGTCTGTCTGG No data
1181091513_1181091516 -7 Left 1181091513 22:20476206-20476228 CCAAGCCCTCGGGGCACTTTCCC No data
Right 1181091516 22:20476222-20476244 CTTTCCCATGCTCTTTACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181091513 Original CRISPR GGGAAAGTGCCCCGAGGGCT TGG (reversed) Intronic