ID: 1181093295

View in Genome Browser
Species Human (GRCh38)
Location 22:20489046-20489068
Sequence CCTCTTCGATGTTGTGCTGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181093295_1181093304 22 Left 1181093295 22:20489046-20489068 CCACCAGCACAACATCGAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1181093304 22:20489091-20489113 GCAGCCCTCGGAGCAGAGCCTGG 0: 1
1: 0
2: 6
3: 63
4: 457
1181093295_1181093301 10 Left 1181093295 22:20489046-20489068 CCACCAGCACAACATCGAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1181093301 22:20489079-20489101 CCCGGAGAGCCAGCAGCCCTCGG 0: 1
1: 0
2: 1
3: 34
4: 347
1181093295_1181093298 -8 Left 1181093295 22:20489046-20489068 CCACCAGCACAACATCGAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1181093298 22:20489061-20489083 CGAAGAGGATTCCGCTGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 48
1181093295_1181093305 23 Left 1181093295 22:20489046-20489068 CCACCAGCACAACATCGAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1181093305 22:20489092-20489114 CAGCCCTCGGAGCAGAGCCTGGG 0: 1
1: 1
2: 2
3: 26
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181093295 Original CRISPR CCTCTTCGATGTTGTGCTGG TGG (reversed) Exonic
905000042 1:34660927-34660949 CCTCTTCATTGTTTTCCTGGTGG + Intergenic
906991603 1:50745526-50745548 CCTCTTTGATGCTGTTCTTGTGG + Intronic
909084008 1:71150399-71150421 CCTATCCAATGTAGTGCTGGAGG + Intergenic
919869429 1:201809240-201809262 CCCCTTTGATGATGTGCTGCGGG - Exonic
920634700 1:207689038-207689060 TCTATTCAATGTTGTACTGGAGG - Intronic
921640622 1:217548252-217548274 CCTATTGGAGGTTGTGGTGGGGG + Intronic
1067221746 10:44348819-44348841 GGTCTTCCATGGTGTGCTGGAGG - Intergenic
1067448301 10:46366557-46366579 CCTCTTCCATGATGGGGTGGTGG + Intergenic
1067589076 10:47494209-47494231 CCTCTTCCATGATGGGGTGGTGG - Intergenic
1067636201 10:48002300-48002322 CCTCTTCCATGATGGGGTGGTGG - Intergenic
1067877286 10:50018023-50018045 CCTCTTCCATGATGGGGTGGTGG + Intergenic
1070132762 10:73666305-73666327 CCTCTTCCATGATGGGGTGGTGG - Intergenic
1071608918 10:87017769-87017791 CCTCTTCCATGATGGGGTGGTGG + Intergenic
1073179685 10:101576088-101576110 CCTGTTGGATTTTGAGCTGGTGG - Intronic
1073445888 10:103580093-103580115 CCTCCTCTAGGTGGTGCTGGGGG - Intronic
1075454318 10:122575173-122575195 GCTGTTCAATGTTGTACTGGAGG + Intronic
1081587901 11:44399843-44399865 CCACTTCCTTGTTCTGCTGGTGG + Intergenic
1083486700 11:62987590-62987612 CCTCCTCCTTGTTCTGCTGGAGG + Intergenic
1084151585 11:67290071-67290093 CCTGTTCAATGTCGTGCTGGGGG - Exonic
1084358781 11:68656380-68656402 CCTTTTCCATCTTCTGCTGGTGG - Intergenic
1084813049 11:71627151-71627173 CCTGTTCTTGGTTGTGCTGGGGG + Intergenic
1089107061 11:116020027-116020049 GCTCTTAAATATTGTGCTGGAGG - Intergenic
1089209520 11:116790889-116790911 CCTCTGCCATGTAGGGCTGGAGG + Exonic
1090456140 11:126851253-126851275 TCACTTAGATGATGTGCTGGTGG + Intronic
1091397667 12:163598-163620 CCTCTTCAATGACCTGCTGGTGG + Exonic
1095207288 12:39453251-39453273 CCTTTTTGTTGTTGTGGTGGTGG - Intergenic
1095960943 12:47833848-47833870 GCTCCACGGTGTTGTGCTGGTGG - Intergenic
1097917093 12:65032472-65032494 CCTATTCAATGTAGTGTTGGAGG - Intergenic
1103033619 12:117638830-117638852 CCCCTTAAATTTTGTGCTGGAGG - Intronic
1107592136 13:41919767-41919789 CATCTTCTCTGGTGTGCTGGAGG - Intronic
1109548783 13:63864623-63864645 TCTATTCAATGTTGTACTGGAGG + Intergenic
1114424502 14:22610903-22610925 CATCTTCAATGCTGTGGTGGAGG + Exonic
1114609111 14:24024864-24024886 CTTCATGGATGTTGGGCTGGGGG + Intergenic
1119189902 14:72674158-72674180 CCTCTTCCATCTTGTGGTGCTGG - Intronic
1123018072 14:105384940-105384962 CCTCTGCGATGGGGAGCTGGTGG - Exonic
1124361278 15:29038208-29038230 CCTCTTCGTTTTGGTGTTGGGGG + Intronic
1128733984 15:70041466-70041488 TCTGTTCAACGTTGTGCTGGAGG - Intergenic
1130225779 15:82057466-82057488 CCTCTTCTATTTTGTGGTGCAGG - Intergenic
1132341682 15:101082818-101082840 CCACTTCTATGATATGCTGGTGG - Intergenic
1136355215 16:29740641-29740663 CCTTTACGGTGTTGGGCTGGGGG - Intergenic
1138563752 16:57817500-57817522 CCTCTTCCAGCTTCTGCTGGAGG + Intronic
1143603052 17:7961946-7961968 CCTCTTAGATGCTGTTCTTGGGG - Intergenic
1144119798 17:12140799-12140821 GCTCTTAGATGGTGTGGTGGAGG + Intronic
1146684323 17:34830613-34830635 TCTCTTCTCTCTTGTGCTGGGGG - Intergenic
1148819585 17:50352903-50352925 CTTCCTCGAGGCTGTGCTGGAGG + Intronic
1149353877 17:55819272-55819294 CCTTTTCAAAATTGTGCTGGAGG + Intronic
1153926944 18:9842726-9842748 CCTCTGGCATGTGGTGCTGGTGG + Intronic
1159775967 18:72602947-72602969 CTCCTTCCATGGTGTGCTGGAGG + Intronic
1160382567 18:78471792-78471814 CCTCTTAAATGTTGTGCCTGAGG - Intergenic
1162123203 19:8485117-8485139 CCTCTAGGATGCTCTGCTGGGGG - Intronic
1165183672 19:33996868-33996890 TCTCTTCAATGTTGTACTGGAGG + Intergenic
1167145543 19:47679479-47679501 CCTCTTGGAGGCTCTGCTGGAGG - Exonic
930019889 2:46995145-46995167 CTTCCTCGATGTTGTCCTTGGGG - Exonic
931913344 2:66926165-66926187 CCTCGTGGCTGTTGGGCTGGGGG - Intergenic
933593548 2:84260097-84260119 CTTCTTTGATCTTGAGCTGGGGG - Intergenic
934033809 2:88071679-88071701 CCTCTTAGGTGTTGTGGTTGGGG + Intronic
937199075 2:120185472-120185494 CCTCTTCCATCTTGTGCTCCAGG - Intergenic
938321765 2:130370943-130370965 CCTCTTTGATGTTCTGGTAGTGG - Exonic
941127125 2:161597530-161597552 CCTATTCAACATTGTGCTGGAGG + Intronic
942741058 2:179178559-179178581 CTTCTTAGATGTTTTGTTGGTGG - Intronic
946189386 2:218000039-218000061 GCTTTTTGATGTTGTGCTGGAGG - Intronic
946859993 2:223991759-223991781 CCTGTTCTAGGATGTGCTGGCGG - Intronic
946914358 2:224501701-224501723 ACTCTTAGATGGTGTACTGGGGG + Intronic
947080740 2:226392848-226392870 CCTCCTCTATACTGTGCTGGTGG - Intergenic
1169775298 20:9245606-9245628 CCTCTTCCAACTTCTGCTGGTGG - Intronic
1172303195 20:33863931-33863953 CCTTCTCACTGTTGTGCTGGAGG - Intergenic
1172891018 20:38264254-38264276 CCTTTTTGTTGTTGTGGTGGTGG - Intronic
1180202095 21:46230012-46230034 CCCCTTCGAAGTTAGGCTGGGGG - Intergenic
1180473563 22:15683626-15683648 CCTCTTCGTTGTTGTTGTTGAGG + Intergenic
1180967055 22:19795864-19795886 CCTCTTGGTGGCTGTGCTGGTGG - Intronic
1181093295 22:20489046-20489068 CCTCTTCGATGTTGTGCTGGTGG - Exonic
1181539789 22:23566920-23566942 CCTCTTAGCTGTTGGGATGGCGG + Intergenic
950020300 3:9782599-9782621 TCTCTTAGATATTGTGCTGGGGG - Intronic
951399865 3:22218592-22218614 TCTGTTCAATGTTGTGCTGAAGG - Intronic
954367133 3:50152175-50152197 CCTCTCCGATCTGGTGCTGCAGG + Intergenic
960894052 3:122482966-122482988 CCTCTTTGATATTTTGGTGGTGG - Intronic
961987647 3:131154644-131154666 CCTCTTAGATTTTGTGCCTGAGG + Intronic
964066200 3:152582979-152583001 CCTCTTTGATGGTGTGCTGCTGG - Intergenic
965292472 3:166900954-166900976 CCTCTTCTATGTCATGCTGAGGG - Intergenic
967713116 3:192732071-192732093 CCTCTTCCATTTTGGGATGGGGG - Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969735703 4:8988552-8988574 TCTGTTCTTTGTTGTGCTGGGGG + Intergenic
970998190 4:22291945-22291967 CCTCTCTGAAGTTGTCCTGGTGG + Intergenic
972332161 4:38074012-38074034 CCTCTTGGATAGTGTGCTGCTGG + Intronic
974874290 4:67684101-67684123 CCACTTTGATTTTGGGCTGGGGG - Intronic
975083103 4:70304090-70304112 CCTTTTTGTTTTTGTGCTGGGGG - Intergenic
977820565 4:101467620-101467642 TCTTTTGCATGTTGTGCTGGTGG + Intronic
980863378 4:138525635-138525657 CCTCTTCAATATAGTACTGGGGG + Intergenic
982986111 4:162208946-162208968 TCTATTCAATGTTGTCCTGGTGG + Intergenic
984878303 4:184388925-184388947 CCTCTTTGATGGTGACCTGGAGG + Exonic
988496755 5:31751849-31751871 CCTCTTTGAAGCTGGGCTGGGGG + Intronic
989621345 5:43387616-43387638 CCTTTTTGTTGTTGTGGTGGTGG + Intronic
992706898 5:79405016-79405038 CCTCTTCGATTCTGTGCGTGAGG + Intronic
993616755 5:90122528-90122550 CCTCTTCTATGTGGTGCAGAAGG + Intergenic
1001407060 5:171483805-171483827 CCTCTTGGATTCTGTGATGGAGG + Intergenic
1004911475 6:20289261-20289283 TCTCTTAGATGTTCTACTGGGGG - Intergenic
1006314259 6:33280713-33280735 CCCCTTTGAAGATGTGCTGGGGG - Exonic
1007635874 6:43299440-43299462 CTTCTTCGCCGGTGTGCTGGTGG + Exonic
1019222026 6:170480464-170480486 CCTTTTCCAAGTTGTTCTGGAGG - Intergenic
1024258699 7:47558458-47558480 CCTCTTTGAAGTTGGGCTGATGG - Intronic
1029726307 7:102407857-102407879 CCTCCTCGATCTTGTCCAGGAGG + Intronic
1034435326 7:151060381-151060403 GCTCTTCCATGTGGGGCTGGCGG - Intronic
1037591217 8:20313539-20313561 CCTCTTTGAGGTTCTCCTGGAGG + Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045697726 8:104829142-104829164 CCTCTTATACCTTGTGCTGGGGG - Intronic
1047834748 8:128676375-128676397 CCTATTCAATGTAGTACTGGAGG + Intergenic
1050531719 9:6596222-6596244 CCTCTACAATATTGTGGTGGAGG - Intronic
1052018996 9:23503742-23503764 TCTATTCAATGTTGTGCTGAAGG - Intergenic
1055021062 9:71670395-71670417 TCTCTTTGTTGTTGTGTTGGTGG + Intergenic
1060472546 9:123960524-123960546 CCTCCTGTATGTTGTACTGGGGG + Intergenic
1192131126 X:68551655-68551677 TGTATTCAATGTTGTGCTGGAGG + Intergenic
1193555008 X:82942885-82942907 CCTATTCAATGTTATACTGGAGG - Intergenic
1200223403 X:154403292-154403314 CCTCTACGATGTGTTTCTGGAGG - Exonic