ID: 1181097773

View in Genome Browser
Species Human (GRCh38)
Location 22:20517658-20517680
Sequence CTCTCAGGACTGCTGTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181097767_1181097773 25 Left 1181097767 22:20517610-20517632 CCTAGTCTGAACTCGTCAGGGCA 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1181097773 22:20517658-20517680 CTCTCAGGACTGCTGTAGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 146
1181097764_1181097773 28 Left 1181097764 22:20517607-20517629 CCTCCTAGTCTGAACTCGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1181097773 22:20517658-20517680 CTCTCAGGACTGCTGTAGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181097773 Original CRISPR CTCTCAGGACTGCTGTAGCA GGG Intronic
900649682 1:3724602-3724624 TTCTCAGAACTGCTGTCACACGG - Intronic
902133096 1:14280709-14280731 TTCCCAGGACTGCTGTAATAAGG - Intergenic
902745457 1:18470769-18470791 CTCTCGTCACTGCTGTAACACGG - Intergenic
903576672 1:24343629-24343651 CTCGGAGGACAGCTGTAACAGGG - Intronic
904753615 1:32755810-32755832 CTTTCAGGACTGCTGGGGCAGGG - Intronic
909324751 1:74336506-74336528 CTCTGGGGACTGTTGTGGCATGG - Intronic
912902835 1:113671318-113671340 GTCTCAGGAATGCTGGAACACGG - Intronic
913373913 1:118130559-118130581 ATCTCAAGACTGCGGTAGAATGG + Intronic
915201681 1:154234580-154234602 CTCCCAGGAATGCTATAGAAGGG - Exonic
917009455 1:170454874-170454896 CTCTCAACACTGCTTTAGCTGGG + Intergenic
919723855 1:200869561-200869583 CTCTCTGCACTGCTGGAGCCAGG - Intergenic
919874627 1:201854620-201854642 CTCTGTGAACTGCTGTACCACGG - Exonic
922602569 1:226868179-226868201 TTCCCAGGAATTCTGTAGCAAGG + Intergenic
922974743 1:229774904-229774926 CTCTGAGAAGTCCTGTAGCAAGG - Intergenic
1063300619 10:4846028-4846050 CGCTCAGAACTGCTGCTGCAAGG + Intronic
1064333827 10:14419784-14419806 CTCTGGGGACTGTTGTGGCATGG + Intronic
1065754706 10:28920419-28920441 CACTCAGGTCTGCTCTATCAGGG - Intergenic
1066065990 10:31761190-31761212 CTCTCAGGACTTCAGAGGCAAGG + Intergenic
1066426084 10:35308930-35308952 TTTTCAGGACTGCTGAGGCAAGG - Intronic
1066817936 10:39446647-39446669 CTCTGGGGACTGCTGTAGGGTGG - Intergenic
1066930771 10:41755180-41755202 CTCTGGGGACTGTTGTGGCATGG + Intergenic
1069370358 10:67741144-67741166 CTCTGGGGACTGTTGTGGCATGG + Intergenic
1069769233 10:70887348-70887370 CTCTCTGGACTGATGTAGCTTGG + Intronic
1070602923 10:77878189-77878211 CTCCCAGGGCAACTGTAGCAAGG + Intronic
1078105578 11:8356296-8356318 CTCACAGGACTGCTGTGGGCAGG - Intergenic
1079114947 11:17634933-17634955 CTCTCACCACAGCTGTAGCTGGG - Exonic
1082254750 11:50021310-50021332 CTCCCAGGTTTGCTGCAGCAGGG - Intergenic
1083493715 11:63032320-63032342 TTCTTAGGGCTGCTGTAACATGG + Intergenic
1083596888 11:63921934-63921956 CTCTCAACACTGTTGTAGTAGGG - Intergenic
1085509654 11:77081836-77081858 CACTCAGGTCTGCTGCAGCAGGG - Intronic
1085703014 11:78761923-78761945 CTCCCAGGCCTGCTGTAGCTTGG + Intronic
1086048534 11:82561526-82561548 CTCACAAAAGTGCTGTAGCATGG - Intergenic
1090863261 11:130673073-130673095 CTCACAGGACGGCTGGAGCTGGG - Exonic
1092537895 12:9404407-9404429 CTCTTAGGACTGCCATCGCAGGG + Intergenic
1095204162 12:39420350-39420372 CTCTCATCACAGATGTAGCAAGG + Intronic
1095280048 12:40340405-40340427 TGCTCAGTACTGCTGTAGAATGG + Exonic
1096245215 12:49981046-49981068 CTCTCTGGGCAGCTGTGGCAGGG + Intronic
1104277534 12:127343442-127343464 CTCTCAGATCTGCTCTACCATGG + Intergenic
1106652629 13:31708138-31708160 CTGTCAGGAATGATGTTGCAGGG + Intergenic
1106700754 13:32225891-32225913 CTCTCGGGTCTGCAGGAGCACGG - Exonic
1108408680 13:50127254-50127276 GTCTTAGGAGTGCTGTGGCAGGG - Intronic
1112784899 13:102940815-102940837 CTCACAGGACAGCAGTTGCAGGG - Intergenic
1113060665 13:106319281-106319303 CTCTCAGGAATCCTGTAAGACGG + Intergenic
1113216647 13:108048658-108048680 TCCTCAGGGCTGCTGTAGCACGG + Intergenic
1113847546 13:113401312-113401334 CTCCCAGGACTGCAGGGGCAGGG + Intergenic
1118390991 14:65295170-65295192 CTTTCAGGATTGCTGCAGCAGGG + Intergenic
1119205309 14:72789578-72789600 CACTCAGGAGTGCAGTGGCATGG + Intronic
1121632872 14:95433586-95433608 CTCTCAGGAATGCTACAGGATGG + Intronic
1127857172 15:62962316-62962338 CCCACAGGACTGGTGTTGCAGGG + Intergenic
1128290702 15:66476403-66476425 CTCCCAGGACTCCAGGAGCAGGG + Intronic
1130338159 15:82975406-82975428 CTCTCATGTTTGCTGCAGCACGG + Intronic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1132581721 16:687794-687816 CCCTCAGAACAGCTGTGGCATGG + Intronic
1139921046 16:70460883-70460905 CCCTCAGGTCAGCTGCAGCAGGG - Intronic
1141225384 16:82110161-82110183 CTCTCAGGACAGCTGTGAAAGGG + Intergenic
1142319062 16:89369406-89369428 CTCTGATGCCTGCTGCAGCAAGG + Intronic
1144046557 17:11459358-11459380 CTCTGAGCAATGCTATAGCAGGG - Intronic
1148053615 17:44780919-44780941 CTCTCAGGCTCGCTGCAGCAGGG - Exonic
1148203362 17:45764434-45764456 CTCTGAGGAGTCCTGCAGCAAGG + Intergenic
1149679613 17:58496184-58496206 CCCTCAGGATTGCTGTGCCAGGG + Exonic
1151876963 17:76872274-76872296 AGCTCATGACTGCTGCAGCAAGG + Intronic
1151952409 17:77362416-77362438 CTTGCAGGACTGCTGGGGCAAGG + Intronic
1153755521 18:8279311-8279333 CTCTCAAGCCTGATGTAGCAGGG + Intronic
1158101540 18:53834977-53834999 CCCTCTGCACTGCTGTAGTAGGG - Intergenic
1158272552 18:55732705-55732727 TTCTCAGGACTCCTGTATCAGGG - Intergenic
1160053400 18:75456994-75457016 CTCTCAGGGCTGCTGTGGTCAGG + Intergenic
1161301295 19:3544310-3544332 CCCTCAGGACGGCTGGAGCCTGG - Exonic
1161692150 19:5742436-5742458 CTCTCAGCACTGCTACAGCCAGG + Intronic
1164821750 19:31256158-31256180 CTCATAGGACTGCTGCAGGATGG + Intergenic
1167279182 19:48556554-48556576 CACTCAGGTCTGCTGCAGGATGG - Intronic
927943168 2:27118548-27118570 CCCCCAGGACTGCTGGAACACGG + Intronic
928802057 2:35107006-35107028 CTCTGGGGACTGCTGTGGGATGG - Intergenic
929925858 2:46207931-46207953 CTCTCAGGCCTGCTGCACCTGGG + Intergenic
932306587 2:70707941-70707963 CCAACAGGACTGCTGGAGCAAGG - Intronic
935296129 2:101651204-101651226 CTTTCAGGGCTGCTATAACAAGG - Intergenic
935708864 2:105879971-105879993 CTCTCAGGACAGCTGAGGAAGGG + Intronic
937650668 2:124315660-124315682 CTGTCAGGCTTGCTGTAGGAGGG - Intronic
940710628 2:157159132-157159154 CTCTCAGAAATGCTGTTGAAAGG + Intergenic
941062176 2:160859743-160859765 CTCACAGTATTGTTGTAGCAGGG - Intergenic
1171037826 20:21730516-21730538 CTCTGAGGACTGCAGAAGCTGGG + Intergenic
1171186291 20:23126465-23126487 CGCTCAGGTCTTCTGTTGCATGG + Intergenic
1171340580 20:24424004-24424026 CTCACAGGACAGCCCTAGCATGG + Intergenic
1171776932 20:29377492-29377514 CTCTCATGTTTGCTGCAGCATGG - Intergenic
1173705336 20:45106197-45106219 CTCACAGAACTGCTGGAACAGGG + Intergenic
1174354720 20:49990119-49990141 CTCTCAGGGCACCTGGAGCAAGG + Intergenic
1176948101 21:15008733-15008755 CTTTGAGGACTGCTGTATTATGG - Intronic
1177770712 21:25512653-25512675 TTCTCAGGACGTCTTTAGCAGGG - Intergenic
1180931757 22:19596916-19596938 GCCTCAGATCTGCTGTAGCAGGG - Intergenic
1181097773 22:20517658-20517680 CTCTCAGGACTGCTGTAGCAGGG + Intronic
1181633416 22:24163308-24163330 CTCCCAGGGCTGCTAGAGCAGGG + Intronic
1185316376 22:50180968-50180990 CGCTCAGGACTGCTCCAGGAGGG - Intergenic
949423865 3:3895113-3895135 CTCTGGGGACTGTTGTGGCATGG - Intronic
949884107 3:8681063-8681085 CTCTTAGGACTTCCATAGCAGGG + Intronic
949884133 3:8681142-8681164 CTCTTAGGACTTCCATAGCAGGG + Intronic
951036109 3:17933982-17934004 ATCTTAAGAGTGCTGTAGCACGG - Intronic
951331619 3:21376419-21376441 CTCTCAGCACTACTATAGCTAGG + Intergenic
951718910 3:25677845-25677867 CTCTCAGGCTTGTTGGAGCATGG + Intergenic
952674710 3:36013687-36013709 CTCTCAGGTCTGCAGCTGCAGGG - Intergenic
954800341 3:53183545-53183567 CTCTGGGGACTGGTGAAGCAGGG + Exonic
956352217 3:68350225-68350247 CTCTCAGGTCTTCTAGAGCAGGG - Intronic
957424437 3:80020047-80020069 CTCTCAGGACCTCTCTAGCCTGG - Intergenic
962324600 3:134422886-134422908 CTCTCAGGACTACTGTCTCCTGG + Intergenic
965541832 3:169878991-169879013 CTCCCATGATTGCTGCAGCAAGG - Intergenic
969557798 4:7925097-7925119 TTCTCAGAGCTGCTGTGGCAAGG - Intronic
970074300 4:12199916-12199938 CTCTAAGAACAGCTGTTGCATGG + Intergenic
970261337 4:14227970-14227992 CTGGCAGGACTTGTGTAGCAAGG + Intergenic
972170494 4:36340154-36340176 CCATCAGAACTGCTGTAGGAAGG + Intronic
973117911 4:46484320-46484342 CTCCCAAGAATTCTGTAGCAGGG - Intergenic
974426553 4:61749694-61749716 CTCTCGGGACTGTTGTAGGGTGG + Intronic
976481047 4:85545507-85545529 CTATCAGGTATGCTGCAGCAGGG + Intronic
984239444 4:177200011-177200033 CTCTCAAGAGTGCTGGAGCAGGG - Intergenic
986327418 5:6686589-6686611 CTCTCAGCAGTACTGTAGCGGGG + Intergenic
988875973 5:35446109-35446131 CTCTGTGGACTGTTGTGGCATGG + Intergenic
989530937 5:42507724-42507746 CTCTCAGGACTAGAGTAACACGG - Intronic
996168554 5:120259457-120259479 ATCTCAGGAATGATATAGCATGG - Intergenic
998070923 5:139197642-139197664 CTCTCCTGACTTCTGAAGCAGGG + Intronic
999147522 5:149406130-149406152 TTCTCAGGACTGCGGTGGCAGGG + Intergenic
999454483 5:151703334-151703356 CTCTAGGGACAGCTGCAGCAAGG - Intergenic
999770100 5:154769236-154769258 CTCTCATGACTGCTGTCTGATGG + Intronic
1000384950 5:160666411-160666433 ATCTCAGAACTACTGTAGGAGGG - Intronic
1001825120 5:174738501-174738523 CTCTCAAAACTGCTGCTGCAGGG + Intergenic
1005859516 6:29889652-29889674 CTCTCTGGAGAGCTTTAGCAGGG + Intergenic
1008864642 6:56194861-56194883 CTCTCAGTACTGCTGCATTAAGG - Intronic
1011709961 6:90043248-90043270 CTCTCAACACTGCTGTCGCAAGG - Intronic
1012341338 6:98128676-98128698 CACTCAGGTGTGTTGTAGCAGGG + Intergenic
1012518658 6:100093466-100093488 CCCTCTGGACTGCTTTGGCAAGG - Intergenic
1015460412 6:133485126-133485148 CTCTCAGCACTGCTGCGTCATGG + Intronic
1020490717 7:8780693-8780715 CTCTCAGTATTAATGTAGCAAGG - Intergenic
1022604322 7:31793890-31793912 GTCTTAGCAGTGCTGTAGCATGG - Intronic
1025074446 7:55930803-55930825 CACTCAGCTCTGCTGTTGCAGGG - Intronic
1025722526 7:64029319-64029341 CTCACAGGTCTGCTGAATCATGG + Intergenic
1025751263 7:64295627-64295649 CTCACAGGTCTGCTGAATCATGG + Intergenic
1027494230 7:78867526-78867548 CTCTGGGGACTGCTGTGGCGTGG + Intronic
1027808557 7:82861948-82861970 CTCTCAGTACTGCTTTTGCATGG - Intronic
1033986549 7:147233204-147233226 CTCTCATGACTGTTTTAGCAGGG + Intronic
1035380892 7:158440331-158440353 ATCTCAGGACTGGTGCAGTAGGG + Intronic
1036986476 8:13537384-13537406 CTTTCATGATTTCTGTAGCATGG + Intergenic
1039577905 8:38639729-38639751 CTCTCAATACTGCTGTATTAGGG - Intergenic
1042488331 8:69371058-69371080 CTCACAGGACTCCTGGAGAAAGG - Intergenic
1043189591 8:77201852-77201874 CTCTGGGGACTGTTGTGGCATGG - Intergenic
1044915925 8:97112683-97112705 CTGTCAGTGCTGCTGCAGCACGG - Intronic
1049156910 8:141072908-141072930 CTCTCTGTACTGCAGTAGCCTGG - Intergenic
1049562887 8:143320909-143320931 CTCCCAGGGCTGCTGGAGGAAGG - Intronic
1053214925 9:36262744-36262766 CTGTCAGGGGTGCTGTAGGAAGG - Intronic
1055855885 9:80688024-80688046 CTCACAGGACTGCTGGAAAATGG - Intergenic
1056752446 9:89362413-89362435 CTTTCAGGAAAGCTGTAGCAAGG - Intronic
1057719534 9:97520824-97520846 CTATGAGGACTGCTGAAGGAGGG - Intronic
1059637459 9:116184861-116184883 TTCCCATGCCTGCTGTAGCAAGG + Intronic
1060879771 9:127109961-127109983 CGGTGAGGACTGCTGGAGCAAGG - Intronic
1060916561 9:127395469-127395491 GTCTGAGGAGTGATGTAGCAAGG + Intergenic
1062141620 9:134962175-134962197 CTCTCAGGCCAGCAGCAGCAAGG + Intergenic
1062387283 9:136317850-136317872 CTCCCAGGACCGCTGGAGGAGGG + Intergenic
1187498733 X:19819862-19819884 CTCTCAGTACTGCTTTAGCTGGG + Intronic
1189631264 X:42956151-42956173 CTCTCATGATTGTTGTAGCTTGG + Intergenic
1191076129 X:56455356-56455378 CTCTGGGGACTGTTGTAGCGTGG - Intergenic
1191719872 X:64220441-64220463 CACTAAGGAGTGATGTAGCAAGG - Intergenic
1191762259 X:64658521-64658543 CTCTGGGGACTGTTGTGGCATGG - Intergenic
1192946724 X:75971069-75971091 CTCTGAGGACTGTTGTAGGGTGG + Intergenic
1193002125 X:76574642-76574664 CTCTGGGGACTGTTGTGGCATGG - Intergenic
1194761997 X:97806000-97806022 CATTCAGGAGTGCTGTAGGAAGG + Intergenic
1195248596 X:103020616-103020638 CTCTGGGGACTGTTGTGGCATGG - Intergenic
1195280977 X:103332369-103332391 CTCACAGGGCTGCTGTGGGAAGG + Intergenic