ID: 1181102537

View in Genome Browser
Species Human (GRCh38)
Location 22:20551050-20551072
Sequence CACCCACGGCTGCCTCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181102532_1181102537 11 Left 1181102532 22:20551016-20551038 CCTTCTTTACAGATAGTGCAAAG 0: 1
1: 0
2: 1
3: 11
4: 316
Right 1181102537 22:20551050-20551072 CACCCACGGCTGCCTCTGACAGG 0: 1
1: 0
2: 0
3: 17
4: 219
1181102531_1181102537 12 Left 1181102531 22:20551015-20551037 CCCTTCTTTACAGATAGTGCAAA 0: 1
1: 0
2: 1
3: 35
4: 510
Right 1181102537 22:20551050-20551072 CACCCACGGCTGCCTCTGACAGG 0: 1
1: 0
2: 0
3: 17
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181102537 Original CRISPR CACCCACGGCTGCCTCTGAC AGG Intronic
900103958 1:974343-974365 GAACCCTGGCTGCCTCTGACAGG + Exonic
900531714 1:3157064-3157086 CAGCCACGGCTGGTTCTGGCCGG - Intronic
901325136 1:8361015-8361037 CCCCCGCTGCAGCCTCTGACTGG - Exonic
901679578 1:10905213-10905235 CAGCGCCGGCTGCCTCTGGCAGG + Intergenic
901768661 1:11519543-11519565 GACCCAGCGCTGCCTCTGCCAGG + Intronic
902210600 1:14901790-14901812 CCCCCACAGCTGCCTCTCTCTGG + Intronic
902980381 1:20118466-20118488 TACCCTTGGCTGCCACTGACAGG + Intronic
903140274 1:21335080-21335102 CACCCTCCACTGCCTCTGCCCGG + Intronic
903653659 1:24935802-24935824 CACCCTCAGGTGCCTCTGAAGGG + Intronic
903813422 1:26047037-26047059 CCCCCACGCTGGCCTCTGACAGG + Intergenic
904237140 1:29123162-29123184 CACCCATCCCTGCCTCCGACTGG + Intronic
904350430 1:29901842-29901864 CTCCCAGGGCTGCCTTTGAGGGG + Intergenic
905943584 1:41883662-41883684 CCCACCAGGCTGCCTCTGACAGG - Intronic
906103756 1:43279498-43279520 CACCCACAGCTGGTTCTGAGGGG + Intergenic
906149336 1:43578413-43578435 CTCCCACACCTGGCTCTGACTGG + Intronic
907107715 1:51899298-51899320 CACACACGGTGGCCTCTGCCAGG + Intergenic
907512393 1:54971433-54971455 CACCCACGCCTGCGTCAGGCAGG + Intergenic
908269011 1:62404866-62404888 CACCCTGGGCTGCCTCTCACAGG + Intergenic
908272914 1:62437517-62437539 CACACACGGCTCCCCCTGGCAGG - Intronic
909354784 1:74696132-74696154 CACCCGTGTCAGCCTCTGACTGG + Intergenic
909545050 1:76837269-76837291 CTCCCATGGCTCCCTCTGCCAGG - Intergenic
912384244 1:109263430-109263452 TGCCCAGGCCTGCCTCTGACTGG - Intronic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
918135408 1:181669433-181669455 CACCCACTGCTGTATTTGACTGG + Intronic
918507014 1:185266599-185266621 CTCCCACTGCTTCCTTTGACTGG + Intronic
921360839 1:214329835-214329857 CTCCCTCAGCTGCCTCTGCCTGG - Intronic
922798761 1:228354308-228354330 CACCCAGGGCTGCCTCTTGCTGG + Intronic
924382531 1:243477684-243477706 CCAGCACAGCTGCCTCTGACAGG - Intronic
924395194 1:243611436-243611458 CACCCACGTCAGCCTTTCACAGG - Intronic
924831602 1:247601462-247601484 AACCCACAGCTGGCTCTGAAGGG + Intergenic
1062799385 10:368244-368266 CAGCCCCAGGTGCCTCTGACAGG + Intronic
1065797157 10:29318473-29318495 CACAAAGGGCTGCCTCTGTCTGG + Intergenic
1065945998 10:30605860-30605882 CACAAAGGGCTGCCTCTGTCTGG - Intergenic
1067146063 10:43694767-43694789 CATTCAGGGCTGCCTCTGCCTGG + Intergenic
1067436908 10:46284814-46284836 CACCCCCAGCTGGCTCGGACCGG + Intergenic
1067479035 10:46583691-46583713 CCCCCACGCCTGACTCTGGCTGG + Intronic
1067615703 10:47758110-47758132 CCCCCACGCCTGACTCTGGCTGG - Intergenic
1071928731 10:90441095-90441117 CAGCCACTGCTGCCTCCAACTGG + Intergenic
1073069305 10:100783115-100783137 CACCCAGGGCTGCGCCTGGCTGG + Intronic
1073523282 10:104155195-104155217 CACCCAGGGCAGCCAGTGACCGG - Intronic
1074112129 10:110430141-110430163 CAGCCACAGCTGGCTCTGACTGG - Intergenic
1076014500 10:127016455-127016477 CACCTCCGGCTGTCCCTGACGGG - Intronic
1076146485 10:128126288-128126310 CTCCCGCCGCCGCCTCTGACGGG + Exonic
1076701060 10:132272950-132272972 CACCAACAGCTCCCTCTGCCCGG + Intronic
1076762399 10:132611982-132612004 CTCCCACACCTTCCTCTGACAGG - Intronic
1076809461 10:132879067-132879089 CACCCAAAACTGCCTCTGCCTGG - Intronic
1077177291 11:1196641-1196663 CACCGAAGGCTGCTTCTGTCCGG + Intronic
1077439374 11:2560851-2560873 CATCCACTGCTGCCTCTGCTGGG - Intronic
1077552641 11:3207955-3207977 CACCCACAGCCTCCTCTGACAGG - Intergenic
1078529594 11:12126805-12126827 CACCCACCGCTGCCTCCTTCAGG - Intronic
1080557498 11:33430742-33430764 CTCCCAGGGCTGCTTCTGACAGG - Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083732466 11:64660260-64660282 GACCCACACCTGCCTCTGTCTGG - Intronic
1085683112 11:78596577-78596599 CACCCACTGCTTCCTCTACCTGG - Intergenic
1087696557 11:101383962-101383984 CACACATGGCTGCTTCTTACTGG - Intergenic
1089774845 11:120828946-120828968 CATCCCCGGCAGCCTCTGCCAGG + Intronic
1091185126 11:133640167-133640189 CCACCACGGCTGCCTCAGCCAGG + Intergenic
1091508760 12:1100196-1100218 CACTCACTGCTCCCTTTGACAGG - Intronic
1091750551 12:3019149-3019171 CAGCCTCCGCTGCCTCTGCCAGG + Exonic
1091942683 12:4502752-4502774 TATCCACAGATGCCTCTGACAGG + Intronic
1092970864 12:13693533-13693555 AACCCAGGGCTGCTTCTCACAGG + Intronic
1097195975 12:57242687-57242709 CACCCCAGCCTGCCTCTCACTGG + Intergenic
1098536086 12:71595067-71595089 CATCCAATGCTGCCTGTGACTGG - Intergenic
1103602718 12:122064280-122064302 CACCCAGGGCTGACTCTCACTGG - Intergenic
1104970850 12:132529976-132529998 CACCCACAGCCACCTCTGAGGGG - Intronic
1105688027 13:22805698-22805720 CGCCCTGGTCTGCCTCTGACGGG - Intergenic
1107145628 13:37058017-37058039 CACCCGCTTCTGCCTCTTACAGG - Intronic
1113964446 13:114144706-114144728 CCTCCAAGGCCGCCTCTGACTGG + Intergenic
1113969485 13:114177456-114177478 CACTCACAGCTGCCTCCCACAGG - Intergenic
1120248102 14:82029221-82029243 CCCCCGCAGCTGCCTCTGAAAGG - Intergenic
1121405336 14:93716195-93716217 CACCTATGGCTGCCTTTGTCTGG - Intergenic
1121409951 14:93742934-93742956 CTCCAACAGCTGGCTCTGACGGG - Intronic
1122821867 14:104350910-104350932 CACCCACCGGTGGATCTGACAGG - Intergenic
1123477431 15:20599420-20599442 GACCCAGGGCTGTCTCTGACAGG - Intergenic
1123640585 15:22400962-22400984 GACCCAGGGCTGTCTCTGACAGG + Intergenic
1123662211 15:22574386-22574408 CAGCCACAGCAGCCTCTGTCTGG - Intergenic
1124262007 15:28201121-28201143 CAGCCACAGCAGCCTCTGTCTGG + Intronic
1124316013 15:28668668-28668690 CAGCCACAGCAGCCTCTGTCTGG - Intergenic
1124340327 15:28886075-28886097 CACGCAGGGCCGCCTCTGCCGGG - Exonic
1124439860 15:29677984-29678006 CACCCGCGGCTCCCTCTGCATGG - Intergenic
1128526471 15:68415562-68415584 CACCCACTGCTGCTTCCGGCAGG + Intronic
1128892761 15:71345370-71345392 CACCCCGGGCTGCCTGTGAGAGG + Intronic
1129944646 15:79528159-79528181 CATCCACAGTTGCCTCTGAAAGG - Intergenic
1133331358 16:4976656-4976678 CAAGCAGGGCTGCCTCTTACGGG - Intronic
1133361113 16:5174448-5174470 CACCCCCAGCTGCCTTTGGCTGG - Intergenic
1135111073 16:19691277-19691299 GACACACGGCTGCCTCTCCCTGG + Intronic
1136103227 16:28010640-28010662 CATTCACATCTGCCTCTGACAGG + Intronic
1136103266 16:28010855-28010877 CGCCCGCAACTGCCTCTGACAGG + Intronic
1136610599 16:31362879-31362901 CCCACAGGGCTGCCTCTGGCAGG + Intronic
1136618180 16:31411020-31411042 CCCACAGGGCTGCCTCTGGCTGG + Intronic
1137338057 16:47571262-47571284 CACCCATGGGTGCCTCCTACTGG - Intronic
1137520980 16:49195336-49195358 CACTCACGGTTGCCTCTGCAGGG - Intergenic
1138023076 16:53502622-53502644 GACCCGCGGCGGCCTCGGACCGG + Intronic
1138246035 16:55467916-55467938 CACCCAGATCTGCCTCTGATTGG - Intronic
1139372797 16:66479232-66479254 CATCCCCAGCTGCCTCTGCCCGG + Intronic
1142197399 16:88745154-88745176 GACCCACTGCTGCCTCTTCCAGG + Intronic
1142238655 16:88935186-88935208 AACCCAGGACTGCCCCTGACCGG - Intronic
1143373625 17:6455105-6455127 CAGCCACTGCTGCCTCCCACGGG - Exonic
1143697432 17:8630723-8630745 AACCCACCGCTGCCTCCGCCGGG + Exonic
1144457555 17:15431502-15431524 CACCCAGTGCTGCCTGTGCCAGG - Intergenic
1145976455 17:28986862-28986884 CACCCACCGCAGCCTCTGGAAGG + Intronic
1148232429 17:45944761-45944783 GACCCAAGGGTGCCTCTGAGAGG + Intronic
1149647113 17:58248998-58249020 CTCCCACGGGTGCCTGTGAATGG + Intronic
1149655907 17:58309503-58309525 CTCCCACGGCTTCCTCCGAGAGG + Intronic
1150226413 17:63527039-63527061 CACCCACGCCTGCCCCGCACTGG + Intronic
1151664154 17:75535877-75535899 CACCCACGTCTGCACCTGGCCGG - Intronic
1156482375 18:37444390-37444412 CTCCCACGGTTGCCTCTCTCAGG - Intronic
1159462675 18:68740674-68740696 AACCCAGTGCTGCCTCGGACGGG + Intronic
1160072450 18:75640503-75640525 CAACCACTGCTGCCTCTGATTGG + Intergenic
1160243238 18:77137534-77137556 CACCCCCTGCTGCCTGTGCCTGG + Intergenic
1161442176 19:4298157-4298179 CACCAACGGCAGCCTCAGCCTGG - Exonic
1161589173 19:5121066-5121088 ACCCCACGGCTGCCCCTGGCAGG - Intronic
1163153411 19:15427844-15427866 CACCCACATCTGCCCCTGTCTGG - Intronic
1163415863 19:17186115-17186137 CATCCCCGGCTGCCTCTGGATGG - Intronic
1164792634 19:31001370-31001392 GTCCCACAGCTGCCTCTGTCCGG + Intergenic
1164797514 19:31045948-31045970 CACCCACCTGTGCCTCTCACTGG + Intergenic
1168380034 19:55912497-55912519 CACCTTCGGCTGCTTCAGACAGG + Exonic
925196227 2:1928356-1928378 CACCTACTGCTCCCTCTGAAAGG + Intronic
925637830 2:5959343-5959365 CTCCCCCAGCTGCCTCTGTCAGG - Intergenic
927485575 2:23486363-23486385 CTCCCACGATTGCCACTGACAGG + Intronic
928170934 2:29002599-29002621 CACCCTCAGCAGCCTCTGAGAGG - Exonic
930543280 2:52734675-52734697 GAACCCCTGCTGCCTCTGACAGG - Intergenic
932596432 2:73096394-73096416 CACCCCTGTCTGTCTCTGACTGG - Intronic
934138666 2:89022933-89022955 CCCCCACACCTGCCTCTGCCTGG + Intergenic
934518908 2:95007145-95007167 CACCCACTGATGCCTGTGATGGG + Intergenic
934738813 2:96704360-96704382 CCCCCATGGCTGCCACTCACCGG - Intergenic
937776192 2:125778645-125778667 AAACCACGCCTGCCTTTGACTGG + Intergenic
938407086 2:131038710-131038732 CTGACAAGGCTGCCTCTGACAGG - Intronic
940533462 2:154908389-154908411 CCTCCACTGCTGCCTCTGAGAGG - Intergenic
942544123 2:177044958-177044980 CACACACGGCTCCCACTGGCTGG - Intergenic
943749843 2:191500071-191500093 CAGCCAGCCCTGCCTCTGACAGG - Intergenic
946335331 2:219031774-219031796 CACCCACGTCAGACTCTGAGGGG + Intronic
948135698 2:235634441-235634463 CTCCCACAGCTGCTTGTGACAGG - Intronic
948152010 2:235751910-235751932 CACCTCCTGCTGCCTCTGTCGGG + Intronic
948712478 2:239833655-239833677 CACCCATGGCTGTCCCTGGCCGG + Intergenic
1168747104 20:253027-253049 CACCCAGGGGTGCCTTTGGCTGG + Intergenic
1168790486 20:572766-572788 CACCCACTGCTCCCTCTGCCTGG - Intergenic
1170122728 20:12927784-12927806 CAGCAACTGCAGCCTCTGACCGG + Intergenic
1170205475 20:13793400-13793422 CACCAATGGTTGCCTCTGAATGG - Intronic
1171147527 20:22798583-22798605 CACCCACTTCTGCCTCAGGCAGG - Intergenic
1171190833 20:23158157-23158179 CACCCAGGGCTGCCTGAGAATGG - Intergenic
1173981474 20:47227349-47227371 CAACCACGGCTGGCTGTGAGGGG + Intronic
1174417448 20:50376913-50376935 CCCCTGCGGCTGCATCTGACAGG - Intergenic
1175909283 20:62396960-62396982 CACCCAGCGCTGCCTGAGACTGG + Intronic
1176057060 20:63154563-63154585 CACCCCCACCTGCCTCTCACTGG - Intergenic
1176096029 20:63344994-63345016 CACCCCCGGGTGCCTGTGACCGG - Exonic
1178460359 21:32796947-32796969 CTTCCACGGCTGCCTCTAAAAGG - Intronic
1181102537 22:20551050-20551072 CACCCACGGCTGCCTCTGACAGG + Intronic
1181141777 22:20810746-20810768 CACCTCAGGGTGCCTCTGACTGG - Intronic
1181758370 22:25041029-25041051 CACCCTCGGCTCCTTCTGAAAGG + Exonic
1183100894 22:35583455-35583477 CACCTGCGTCTGCCCCTGACTGG - Intergenic
1184477648 22:44730092-44730114 CCCCCAGGGCTGCCCCTGGCGGG + Intronic
1184855389 22:47143762-47143784 CTCAAACAGCTGCCTCTGACAGG - Intronic
1185203234 22:49521322-49521344 CACCCAGGGCTGCCAATGATCGG + Intronic
1185204781 22:49531632-49531654 CAGCCAGGGCTGCCCCTGCCTGG - Intronic
953343906 3:42159393-42159415 CACCCGGGGCTGCCTTTCACTGG + Intronic
954198855 3:49012451-49012473 CACCCAGGCCTGCCTCTCATGGG - Exonic
954440174 3:50517423-50517445 CACCCACTCCTGCCTCAGAGAGG - Intergenic
956740841 3:72274677-72274699 CAACCACGGCTGCATTTGAGTGG - Intergenic
960970878 3:123139323-123139345 CACCCACGGCTCCCCAAGACAGG + Intronic
961450087 3:126998756-126998778 CAGCCAGGGCTGCCTTAGACAGG - Intronic
961819833 3:129570365-129570387 CACCCCAGGATGGCTCTGACTGG - Intronic
962129866 3:132660712-132660734 CCCCCGCGCCTGCCTCCGACCGG - Exonic
962538331 3:136351718-136351740 CACCCAAGGCTGCCTTTCTCAGG + Intronic
962929669 3:140024612-140024634 CACACGCAGCTGGCTCTGACTGG + Intronic
969391735 4:6895903-6895925 CCCCCACTGCTGCCACTCACAGG + Intergenic
972254136 4:37335269-37335291 CACCCACTGTGCCCTCTGACTGG + Intronic
972336262 4:38109498-38109520 CACCAAGGGCTTCCTCTGAGGGG - Intronic
973967739 4:56181278-56181300 CACCCACTGCTTCCTCTACCTGG - Intronic
976842754 4:89451104-89451126 CACCAACTGCTGCCTCTGCCTGG - Intergenic
981513700 4:145584820-145584842 CACCCACCACTGCCTGAGACAGG - Intergenic
981794383 4:148579675-148579697 CACCCACCTCAGCCTCTCACAGG - Intergenic
987737174 5:21861023-21861045 CACCCAGAGCTGCCTCTGCATGG - Intronic
988589709 5:32538231-32538253 CACCCACAGGTGCCTCTCAGAGG + Intronic
995988913 5:118211826-118211848 CACCCACAGCTGTCCTTGACTGG + Intergenic
996599489 5:125245393-125245415 CACCCACCCCTGCCACTGATAGG - Intergenic
997429438 5:133827272-133827294 CACACCTGGCTGCCTCTGACAGG + Intergenic
998174804 5:139895184-139895206 CACCCACAGCCCCCTCTGCCAGG + Intronic
999923079 5:156343993-156344015 CTGCCACGGTTGCCACTGACTGG + Intronic
1001383977 5:171323369-171323391 CAGCCACGGCTGCCTTTCATGGG + Intergenic
1003359811 6:5414124-5414146 TAACCACTGCTGCCTCTGTCGGG - Intronic
1007305095 6:40897598-40897620 GGCCCACTGCTGCCTCTGCCTGG + Intergenic
1007522310 6:42460366-42460388 CTCCCACGGCTGAACCTGACAGG + Intergenic
1010117640 6:72333711-72333733 TACCCACAGCTGTGTCTGACTGG - Exonic
1011594409 6:89002664-89002686 CTCCCACCGCAGCCTCTCACAGG + Intergenic
1012725313 6:102803569-102803591 CACACACGGGGGCCTCTCACGGG - Intergenic
1014946467 6:127504522-127504544 CACCCTTGGCTGCCTGTGAATGG - Intronic
1017603129 6:156105033-156105055 CACCCAATGCTGCCCTTGACAGG + Intergenic
1019024869 6:168951019-168951041 TTTCCACGGCTGCCTCTGAACGG + Intergenic
1019204642 6:170349931-170349953 CACTCACGGCTTCCCCTGGCTGG - Intronic
1019595290 7:1855600-1855622 CACCCACGGCCTCCTCAGAGCGG + Intronic
1019725893 7:2602536-2602558 CACCCACAGCTGCTTCTAAGTGG + Intronic
1020769312 7:12368456-12368478 CACTCACTGCTCCCTCTCACCGG - Intronic
1022301317 7:29105292-29105314 CACCCATGGCTGCCACAGTCTGG - Intronic
1024664856 7:51536354-51536376 CACCCACAGCTGCCCCTTCCCGG + Intergenic
1028557026 7:92135350-92135372 CACCCACGGGAGCACCTGACCGG + Intronic
1033571197 7:142630397-142630419 CACCCATCACTGCCTCTGAAAGG - Intergenic
1034254261 7:149715691-149715713 CATCCATGGCTGCCTCGGACTGG - Intronic
1034946650 7:155266753-155266775 CCTCCACGGCTGCCTCGGCCAGG - Intergenic
1035662179 8:1356441-1356463 CGCCCACTGCAGCCTCTGACGGG - Intergenic
1037513108 8:19603458-19603480 CACCCACTTCCGCCTCTGCCTGG + Intronic
1037826272 8:22162472-22162494 CTCCCACGGCTGCCTAGGGCTGG - Intronic
1038484108 8:27921524-27921546 CACCCACGGCCCCTTCTGATGGG - Intronic
1038490997 8:27971148-27971170 CTCCCAAGGCTGCATCTGAAAGG - Intronic
1044505715 8:93016764-93016786 CACCTGCTGCTGCCTCTGTCGGG - Intronic
1045131944 8:99163618-99163640 CACCCTCGGCAGCCACTGGCCGG + Intronic
1049018962 8:139940962-139940984 CACCCACAGCAGCCTATGAAGGG + Intronic
1049172888 8:141173006-141173028 CAGCCACCTCCGCCTCTGACTGG - Intronic
1049172896 8:141173036-141173058 CAGCCACCTCCGCCTCTGACTGG - Intronic
1049322060 8:142001842-142001864 CAGCCACAGCTGCCTGTGCCCGG - Intergenic
1049437626 8:142595044-142595066 CACCCCCGGGAGCCTCTGAGTGG - Intergenic
1050063621 9:1736048-1736070 CAGCCAGGGCAGCCTCTGGCTGG - Intergenic
1052883517 9:33621559-33621581 CACCCATCACTGCCTCTGAAAGG - Intergenic
1056331666 9:85526174-85526196 GACCCAATGCTCCCTCTGACTGG + Intergenic
1057572745 9:96216777-96216799 CCCCCACCCCTGCCTCTGCCAGG - Intergenic
1057788267 9:98104894-98104916 CTCCCACGGATGCCTCTCATGGG + Intronic
1060213128 9:121722588-121722610 AACCCAGGGCTCCCACTGACTGG + Intronic
1061801522 9:133115622-133115644 CCCCCACTGTTGCCTGTGACAGG - Intronic
1062472534 9:136712750-136712772 CGCCCCCGGCCGCCTCTGCCTGG + Intronic
1185651121 X:1648827-1648849 CAGCCCTGACTGCCTCTGACAGG - Intergenic
1185774020 X:2787660-2787682 CACCCACGTCGGCCTCTGAAAGG - Intronic
1187096647 X:16155853-16155875 CACCAACGGCTGCTGCTGGCAGG + Intergenic
1188404982 X:29796912-29796934 CACTCACTGTTGCCTCTGCCTGG + Intronic
1189612051 X:42747535-42747557 CACCCACTGTTCCCTCTGACTGG + Intergenic
1190054949 X:47175931-47175953 GCCCCAGGGCTGCCTCTGCCGGG - Intronic
1194316740 X:92385964-92385986 CACCCACTACTCCCTCTGAGAGG + Intronic
1195129786 X:101840701-101840723 CACCCACAGGTGCCACTGCCTGG + Intronic
1195176450 X:102319122-102319144 CACCCACAGGTGCCACTGCCTGG - Intronic
1195182414 X:102367971-102367993 CACCCACAGGTGCCACTGCCTGG + Intronic
1195762220 X:108258885-108258907 TTCCCACTGTTGCCTCTGACTGG + Intronic
1196247070 X:113413055-113413077 CTCTCACAGCTGCCTGTGACAGG + Intergenic
1197251120 X:124217455-124217477 CACACATGGCTGCCTCTGGAGGG - Intronic
1198606892 X:138350258-138350280 GTCCCACCGCTGCATCTGACTGG - Intergenic
1200071986 X:153533766-153533788 CAGCCATGGCTGTGTCTGACTGG - Intronic
1200546675 Y:4526883-4526905 CCCCCACAGCTGCTTCTTACAGG - Intergenic
1200624914 Y:5499286-5499308 CACCCACTACTCCCTCTGAGAGG + Intronic
1201295726 Y:12461728-12461750 CACCCACTTCAGCCTCTGAAAGG + Intergenic