ID: 1181104299

View in Genome Browser
Species Human (GRCh38)
Location 22:20564463-20564485
Sequence GCTGCTGCAGCGCCACCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 633
Summary {0: 1, 1: 1, 2: 13, 3: 140, 4: 478}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181104299_1181104300 13 Left 1181104299 22:20564463-20564485 CCAGCAGGTGGCGCTGCAGCAGC 0: 1
1: 1
2: 13
3: 140
4: 478
Right 1181104300 22:20564499-20564521 GCAGTTCCAGCAGCAGCAGCAGG 0: 1
1: 3
2: 20
3: 186
4: 834
1181104299_1181104301 16 Left 1181104299 22:20564463-20564485 CCAGCAGGTGGCGCTGCAGCAGC 0: 1
1: 1
2: 13
3: 140
4: 478
Right 1181104301 22:20564502-20564524 GTTCCAGCAGCAGCAGCAGGCGG 0: 1
1: 1
2: 23
3: 155
4: 875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181104299 Original CRISPR GCTGCTGCAGCGCCACCTGC TGG (reversed) Exonic
900032429 1:381200-381222 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900032445 1:381268-381290 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900032461 1:381336-381358 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900032477 1:381404-381426 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900032493 1:381472-381494 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900032509 1:381540-381562 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900032525 1:381608-381630 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900032540 1:381676-381698 TCTCCTGCAGCGCCGTCTGCTGG - Intergenic
900052979 1:609386-609408 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900052995 1:609454-609476 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053011 1:609522-609544 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053027 1:609590-609612 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053041 1:609654-609676 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053057 1:609722-609744 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053073 1:609790-609812 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053089 1:609858-609880 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053105 1:609926-609948 TCTCCTGCAGCACCGCCTGCTGG - Intergenic
900053121 1:609994-610016 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053137 1:610062-610084 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053151 1:610126-610148 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053167 1:610194-610216 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053183 1:610262-610284 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053199 1:610330-610352 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053215 1:610398-610420 TCTCCTGCAGCACCGCCTGCTGG - Intergenic
900053231 1:610466-610488 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053247 1:610534-610556 TCTCCTGCAGCACCGCCTGCTGG - Intergenic
900053263 1:610602-610624 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053279 1:610670-610692 CCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900053297 1:610738-610760 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
900243769 1:1628632-1628654 GACGCTGCAGCGCCACGTGCAGG - Exonic
900250414 1:1665859-1665881 GGCTCTGCAGCGCCTCCTGCTGG + Exonic
900289312 1:1917187-1917209 GCTGCGGCAGCTGCACCTACTGG - Exonic
900331996 1:2139919-2139941 GCTGCTGGAGAGCCCTCTGCTGG + Intronic
900364761 1:2306585-2306607 CGTGCTGCAGCTTCACCTGCAGG - Exonic
900456644 1:2778124-2778146 GCTGCTGCAGGGCAGGCTGCTGG - Intronic
900704494 1:4071856-4071878 GCTGCTGCTGAGCCACTTCCAGG + Intergenic
900965213 1:5952714-5952736 GCTGCTGGAGCTCCACGTCCAGG - Exonic
900980152 1:6041628-6041650 TCTGCAGCAGCGCCACCCGGTGG - Intronic
901084477 1:6602259-6602281 GCGCCTGCTGCGCTACCTGCGGG - Exonic
901089997 1:6634769-6634791 GGAGCTGCAGTGCCACCTGCTGG + Exonic
901831272 1:11894107-11894129 GAGCCTCCAGCGCCACCTGCTGG + Intergenic
902447840 1:16478391-16478413 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902467740 1:16628604-16628626 CCTGCTGCTGGGCCACCTGCAGG + Intergenic
902506840 1:16944124-16944146 CCTGCTGCTGGGCCACCTGCAGG - Exonic
902761672 1:18584924-18584946 GATCCTGCAGCACCATCTGCTGG + Intergenic
903125641 1:21245569-21245591 GCTCCTACTGCCCCACCTGCAGG + Intronic
903663658 1:24994088-24994110 CCTGCTGCAGCCCCATCTCCGGG + Intergenic
903959186 1:27046089-27046111 TTTGCCTCAGCGCCACCTGCTGG - Intergenic
904376658 1:30086110-30086132 GGTCCTGCAGCGCCACCTTCAGG + Intergenic
905227117 1:36486383-36486405 GCTGCTGCAGCTCCATTTCCTGG - Intergenic
905314880 1:37076027-37076049 GCTGCTGCAGCTTCTGCTGCTGG + Intergenic
905445597 1:38026795-38026817 GGGGCAGCAGCTCCACCTGCTGG - Intergenic
905448998 1:38045423-38045445 GGTGGTGCAGCGCCGCCGGCGGG + Exonic
905695968 1:39973676-39973698 GCAGCTTTGGCGCCACCTGCTGG + Intergenic
905876079 1:41432888-41432910 GCTGCTGCAGCGCCCCCTGCTGG + Intergenic
906104873 1:43285695-43285717 GCTGCGGCAGCGCCTCCAGTGGG + Intergenic
906235580 1:44206378-44206400 GGTTCTGCAGGGCCAACTGCAGG + Intergenic
906950749 1:50333160-50333182 GATGCGGCAGCGCCCCCTGCCGG + Intergenic
908132055 1:61083355-61083377 GCTGCGGCAGCGCAGGCTGCGGG - Intronic
912360262 1:109089388-109089410 TCTGCTGCAGTGCCATCTGCTGG - Intergenic
913163985 1:116168529-116168551 GGTTCGGCAGCGCCTCCTGCCGG + Intergenic
913327739 1:117641720-117641742 GCTGCTGTTGCTCCACTTGCAGG + Intergenic
914911428 1:151790501-151790523 GCGGCTGAAGCGCCGCCGGCGGG - Intronic
915168220 1:153960367-153960389 GCTGTTGCAGAGCCACCTTAGGG - Exonic
915216734 1:154345404-154345426 GTTCCTGCAGCGCCTCCTGCTGG + Exonic
915300210 1:154947416-154947438 GCTGCTGCAGGCCCAGCTGCAGG - Exonic
915731639 1:158058314-158058336 GCAGCAGCAGCGCAACCTGTTGG - Intronic
917139816 1:171824732-171824754 GCTGGTGCAGCACCAGCTGCTGG + Intergenic
918044775 1:180935310-180935332 GCTGCAGCAGCGCCAGCGCCAGG + Exonic
920033016 1:203048666-203048688 GCGTCTGCAGCTCCACCTGAAGG + Intronic
920145972 1:203861434-203861456 GGTCCTACAGCGCCACCTGGAGG - Intergenic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
922161455 1:223081577-223081599 GGTCCTGCAGCACCACCTGGGGG + Intergenic
922473147 1:225888868-225888890 GCTGCAGCAGGGCCACGTACTGG + Exonic
922561179 1:226570667-226570689 GATGCTGCAGCTCCAGGTGCTGG - Intronic
923230603 1:231983132-231983154 GCTGCAGCAGTGTAACCTGCTGG + Intronic
1065019989 10:21495848-21495870 GGGGCAGCAGCGCCCCCTGCAGG - Exonic
1067083680 10:43227298-43227320 GCTGCAGCAGTGCCATCTGTCGG - Intronic
1067562105 10:47311364-47311386 GCTGCTGCAGAGCAGGCTGCAGG - Intronic
1068940997 10:62681228-62681250 GTTGCTGCTGGGCCACCAGCAGG - Intergenic
1070257937 10:74826738-74826760 GCAGCGGCAGCGCCCCCGGCAGG + Exonic
1070288455 10:75100016-75100038 GGTGGTGCAGCCCCACCTGATGG - Intronic
1070809857 10:79292234-79292256 GCTGCTGCAGCGGCTGCCGCGGG - Exonic
1072188454 10:93062770-93062792 CATGCCGCAGCGCCCCCTGCAGG - Exonic
1072518311 10:96208346-96208368 GCAGCTGCAACCTCACCTGCTGG - Intronic
1072520948 10:96229712-96229734 ACTGCAGCTGCGCCCCCTGCTGG - Intronic
1073139678 10:101238906-101238928 GCTGCCACAGCGCCTGCTGCCGG + Intergenic
1073266177 10:102229932-102229954 GGTGCTGCGGCGCCACCTCGTGG - Intergenic
1073641219 10:105254564-105254586 GGTTCTGCAGGGCCAACTGCAGG - Intronic
1073650623 10:105354457-105354479 ACTGCTGCAGAGGCCCCTGCTGG + Intergenic
1074429475 10:113381565-113381587 GCTGATGCAGCTCCACGTGGAGG - Intergenic
1074591876 10:114821726-114821748 GCTGCGGCGGCGCCCCCTGCAGG + Exonic
1074801505 10:117005267-117005289 GCTGCGGCCGCTTCACCTGCAGG + Exonic
1075032135 10:119030416-119030438 GCTGCTGAAGCCCGAGCTGCAGG + Exonic
1075194645 10:120345287-120345309 GATGCTGAAGAGCCACCTGGAGG + Intergenic
1075564254 10:123492213-123492235 ACTGCTCCAGCTGCACCTGCCGG - Intergenic
1076311999 10:129515155-129515177 GCAGCAGCAGATCCACCTGCAGG + Intronic
1076746535 10:132517499-132517521 GCTGCGGCAGGGCCTCCTCCTGG + Intergenic
1076897279 10:133318831-133318853 CTGGCTGCAGCGCCACCTCCTGG + Intronic
1077338017 11:2014081-2014103 GGTGCTGCAGCACCTTCTGCGGG - Intergenic
1077433746 11:2528411-2528433 GCTGCTGCTGGGACACCAGCAGG - Intronic
1077933436 11:6757558-6757580 GTTGCAGCAGCTCCATCTGCTGG + Intergenic
1078264931 11:9747987-9748009 GCTGCTCCATGGCCTCCTGCAGG - Exonic
1078318040 11:10307941-10307963 GAGGCTGTAGCGCCCCCTGCAGG + Intergenic
1080641483 11:34160992-34161014 GGTGGTGCAGAGCCTCCTGCGGG - Exonic
1080687577 11:34528035-34528057 GCTCCTGCAGGGGCACTTGCAGG - Intergenic
1080905780 11:36543394-36543416 GCTGCTGCCAGGCCACATGCCGG + Intronic
1081621434 11:44621310-44621332 GAGGCTGCAGCGCCGCCTGGTGG - Intergenic
1083457284 11:62787396-62787418 GCTGCTGCAGCGGCGCTTCCTGG + Intronic
1083474309 11:62906138-62906160 GTTGCTTTAGCGCCATCTGCCGG - Intergenic
1083678578 11:64341102-64341124 GCAGCTGCAGCTCCTCCTGGAGG - Exonic
1083764578 11:64835803-64835825 CCTGCAGCTGCGTCACCTGCCGG + Exonic
1083800139 11:65041748-65041770 GCTGCTGCAGGCCCAGGTGCAGG + Exonic
1083938934 11:65884821-65884843 GGAGCAGCAGTGCCACCTGCCGG + Intronic
1084084626 11:66849355-66849377 CCCGCTCCAGCTCCACCTGCAGG + Exonic
1084178700 11:67436215-67436237 GCTGCTGCTGCTCCTACTGCTGG - Exonic
1084531507 11:69730527-69730549 GCAGCTGCTCCTCCACCTGCAGG - Intergenic
1085058705 11:73424886-73424908 ACTGCTGCTGAGCCACCTGGGGG + Intronic
1089494551 11:118901690-118901712 GCTGCTGCGGCACCAGCTGCTGG - Exonic
1090000629 11:122954204-122954226 GCTGCTGCAGCTCCAGCTCCAGG + Intronic
1090580901 11:128157820-128157842 GCTGTTACAGCTCCACCTGCTGG - Intergenic
1090799863 11:130163666-130163688 GCAGCTGAAGCCCCACCTACAGG - Intronic
1091290985 11:134439695-134439717 GCCGCTGCACCCCCACCTGTAGG - Intergenic
1202821001 11_KI270721v1_random:69263-69285 GGTGCTGCAGCACCTTCTGCGGG - Intergenic
1091488946 12:916410-916432 GCTGCTGCAGCTGCTTCTGCCGG + Exonic
1091710089 12:2733777-2733799 CCAGATGCAGCCCCACCTGCTGG - Intergenic
1092489510 12:8932717-8932739 GCTGCTGCTGCGCCAACTGGAGG - Exonic
1092936250 12:13366961-13366983 GCTGCTGCTGGCCCACCTGTGGG - Intergenic
1093317307 12:17667103-17667125 GCGGCTGCAGCTGCACCCGCAGG + Intergenic
1095396864 12:41771776-41771798 GCCCCTGCAGAGGCACCTGCAGG + Intergenic
1095945635 12:47751775-47751797 GCAGCTGCATCGGCATCTGCTGG - Exonic
1096053747 12:48633671-48633693 GCTGCTGCTGCTACAACTGCTGG + Intergenic
1096156124 12:49342417-49342439 GCGGCAGGAGCGCCTCCTGCGGG + Intergenic
1096157304 12:49347764-49347786 TCGGCGGCAGCGCCACCTGGCGG + Exonic
1096459488 12:51814419-51814441 GCAGCTGCAGCGTCGCCTGCTGG + Intergenic
1096589308 12:52646855-52646877 CCTGCTGCAGGGCCTCCTCCAGG + Exonic
1096595510 12:52692536-52692558 ACTGCTGCAGGGCCTCCTCCAGG + Exonic
1096670924 12:53197828-53197850 GGTCCTGCAGCACCTCCTGCTGG + Exonic
1096946425 12:55413455-55413477 GCTGCTGCTGCGCCAACTGGAGG + Intergenic
1097402219 12:59142762-59142784 GCAGCTTCAGCCCCACCAGCAGG + Intergenic
1097762441 12:63483091-63483113 GCTGCTGCAGAGCTTCCTGTTGG - Intergenic
1098131156 12:67351849-67351871 GCTCCTGCAGAGCTTCCTGCTGG - Intergenic
1101866389 12:108523515-108523537 GCTGCTGGGGCGGCAACTGCAGG + Exonic
1102418844 12:112788041-112788063 CCTGCTGCAGTGCCACAGGCTGG + Intronic
1103713541 12:122929982-122930004 GCTGGTGCAGCGGCAGATGCTGG - Exonic
1104835409 12:131786878-131786900 GCTGCTGCCCCTCTACCTGCTGG + Intronic
1104835863 12:131789946-131789968 GCTGCTTCAGTGTCACCTCCTGG - Intronic
1105603237 13:21905962-21905984 GCTTCTGCAGCTCCAGCTCCTGG - Intergenic
1105805906 13:23951477-23951499 CCTGATGCAGCTCCCCCTGCAGG - Intergenic
1105858910 13:24392766-24392788 GCTGCTGCTCCCCCTCCTGCAGG + Intergenic
1106033721 13:26025355-26025377 GCTGCAGCAGGGCCAGCTGCAGG + Exonic
1106246422 13:27954022-27954044 GGAGCAGCAGCGCCGCCTGCCGG + Intergenic
1107069742 13:36256924-36256946 GCTGCTGCTGGCCCACCTGTGGG - Intronic
1108450147 13:50554042-50554064 GTTGCTGCAGTGACACCAGCAGG + Intronic
1113200994 13:107867329-107867351 GCTGCCGCAGGGCCGCCCGCGGG + Intergenic
1113482361 13:110630743-110630765 GCTGTTGCAGCACCATGTGCTGG + Intronic
1113890140 13:113731355-113731377 GTGGCTGCAGAGACACCTGCCGG - Intronic
1114604847 14:23988437-23988459 GCTGCTCCAGCCTCACCTGGTGG + Intronic
1114610293 14:24035984-24036006 GCTGCTCCAGCCTCACCTGGTGG + Intergenic
1114658786 14:24331856-24331878 GCTGATGGAGCGCGCCCTGCGGG - Exonic
1116221778 14:42096526-42096548 GCTGCAGCAGTGCAAGCTGCAGG - Intergenic
1118281168 14:64430177-64430199 CCTCCTGCAGCGCCACCTAGGGG - Exonic
1119592915 14:75906879-75906901 ACTGCCACAGCGCCACCTACTGG - Intronic
1119733921 14:76968890-76968912 GCTGGTGCAGCACCAGCTGCTGG - Intergenic
1119840711 14:77790775-77790797 GCTGCTGCTGCCCTTCCTGCTGG - Intergenic
1121226996 14:92328410-92328432 GCACCTGCAGTGCCTCCTGCGGG - Intronic
1122130783 14:99603764-99603786 GCGGCTGCAGCAGCACCTGCTGG - Exonic
1122602936 14:102930283-102930305 GCAGCGGCGGCGCCACCAGCAGG - Exonic
1122624180 14:103075718-103075740 GGTGCTCCAGCGCCCCCTCCCGG - Intergenic
1122820436 14:104342127-104342149 TCGCCTGCAGCGCCACCTGCAGG + Intergenic
1123023043 14:105411216-105411238 GCTGCTCCAGCGCCAGCTCCCGG - Intronic
1124360874 15:29035819-29035841 CATGCAGCAGAGCCACCTGCGGG - Intronic
1125328907 15:38564188-38564210 GCTCCGGCTGCGCCACCTGGTGG - Intronic
1125535907 15:40441137-40441159 GCTGCGTCAGCGCCTCCTCCTGG - Intronic
1125723274 15:41855316-41855338 GCAGCTGCAGCTACACCAGCTGG - Exonic
1125918746 15:43511741-43511763 AGTGCTGCGGAGCCACCTGCGGG + Intronic
1127772905 15:62244972-62244994 GGTTCTTCAGCTCCACCTGCAGG + Intergenic
1127961029 15:63891164-63891186 GCCCTTGCAGCGCCACCTGGTGG + Intergenic
1128455037 15:67827392-67827414 GCGGCGGCAGCGGCAGCTGCTGG + Intronic
1128655138 15:69455230-69455252 GCTGGTGCAGCACCAGCTGCTGG - Exonic
1128719750 15:69939753-69939775 GCTGCTGCTGCCCCAACTCCTGG - Intergenic
1128736135 15:70055012-70055034 GCTGCTGCGCCGCCTCCAGCTGG - Intronic
1129207200 15:74044321-74044343 AGTGCTGCAGCCCCACCTCCAGG - Exonic
1129208919 15:74054194-74054216 GCTGCTCTGGTGCCACCTGCAGG - Intergenic
1129387702 15:75204941-75204963 GGTGCTGCAGCACCATCTGCTGG + Intronic
1129478231 15:75802253-75802275 GCTGCTCTGGTGCCACCTGCAGG + Intergenic
1129836320 15:78709565-78709587 GCTGCTCTGGTGCCACCTGCAGG + Intronic
1132521617 16:392806-392828 GCTGCTGCTCCGCCACCTCCTGG - Intergenic
1132732002 16:1367262-1367284 TCTTCTGCAGCGCCAGCTGCCGG + Intronic
1132783756 16:1642926-1642948 GCACCTGCAGCGCCATCCGCGGG + Intronic
1132841167 16:1979133-1979155 GCTGCTGCACCGTCACACGCAGG - Exonic
1132915190 16:2340341-2340363 GCTGAGGGAGCGGCACCTGCAGG + Intronic
1132999694 16:2842634-2842656 CCTCCTGCAGCGCCCCCTGTTGG - Intergenic
1133035219 16:3030568-3030590 GATGCTGCAGAGCCGCCGGCAGG - Exonic
1133234677 16:4382311-4382333 GGGGCTGCAGCGCTACCTCCAGG + Exonic
1133401526 16:5490749-5490771 GAAGCTGCCGCGCCCCCTGCAGG + Intergenic
1133924436 16:10182042-10182064 CCTGCTGCAGAGCCTCCGGCTGG - Exonic
1134186322 16:12087900-12087922 GCGGCAGCAGCTCCACCAGCAGG - Exonic
1134492143 16:14703329-14703351 GCTGCTGCGGTGCCGCCTGTAGG + Intergenic
1134497524 16:14742451-14742473 GCTGCTGCGGTGCCGCCTGTAGG + Intronic
1135354354 16:21757168-21757190 GCAGCTGCAGAGCCTCCAGCAGG + Exonic
1135452845 16:22573308-22573330 GCAGCTGCAGAGCCTCCAGCAGG + Intergenic
1135869484 16:26136319-26136341 GCTTCTGCAGCTTCACTTGCTGG + Exonic
1136117776 16:28106120-28106142 GCTCCTGGACCACCACCTGCAGG + Exonic
1136156108 16:28383331-28383353 CCTGCTGCTGCGCAGCCTGCAGG - Exonic
1136206978 16:28731957-28731979 CCTGCTGCTGCGCAGCCTGCAGG + Exonic
1136455831 16:30379118-30379140 GCTGGTGCAGACACACCTGCAGG - Exonic
1136933430 16:34437603-34437625 GCGACTGCAGCGCCGCCGGCAGG - Intergenic
1136971142 16:34974211-34974233 GCGACTGCAGCGCCGCCGGCAGG + Intergenic
1137774186 16:51041799-51041821 GCTCCTGCAGAGCCAAGTGCAGG + Intergenic
1137873296 16:51971340-51971362 TCTGCTTCAGCGCCATCTGGAGG + Intergenic
1139289436 16:65844133-65844155 GCTGCTGCACAGCCAGCTGCTGG - Intergenic
1139466047 16:67154765-67154787 GCTGCTGCGGCGCTTCGTGCAGG - Exonic
1139747149 16:69083726-69083748 GAGGCAGCAGGGCCACCTGCTGG - Exonic
1139890901 16:70252765-70252787 CCAGCTGCAGCGCCTCCTGCAGG + Exonic
1139922933 16:70471051-70471073 CCTGCAGCACTGCCACCTGCAGG + Exonic
1140188863 16:72797395-72797417 GTTGCTGCAGCTCCTGCTGCAGG + Exonic
1140205182 16:72927683-72927705 GCTGCTGCAGCTCCCCCGGGCGG - Intronic
1141079132 16:81035743-81035765 GCGGCCGCGGCGCCCCCTGCCGG - Intergenic
1141638801 16:85329476-85329498 GGGGCTGCAGAGCCACCTGCAGG + Intergenic
1141704543 16:85657518-85657540 GCTGCTCCAGCACCTGCTGCCGG - Exonic
1142132374 16:88436941-88436963 GCTGCTGCGGGGGCACCTGCAGG + Exonic
1142132541 16:88437520-88437542 CAAGCTGCAGCGCCACCTGGCGG + Exonic
1142183104 16:88681256-88681278 GCAGCTGCACTGCCACCTGCAGG - Exonic
1142183314 16:88682120-88682142 GCTGCTGCATGGGCACCTGGAGG - Intronic
1142432333 16:90036493-90036515 GCTGATGCAGCGCCACGAGGAGG + Exonic
1142699119 17:1649014-1649036 GCAGCTGCAGCGCCTCCTGCTGG - Exonic
1143408772 17:6696194-6696216 GCTGCTCCAGGGTCACCTGGGGG + Intronic
1144511749 17:15882861-15882883 CATGCTGCAGCACCAGCTGCTGG - Intergenic
1144531648 17:16044828-16044850 ACTGGTGCAGCACCAGCTGCTGG - Intronic
1144608709 17:16690006-16690028 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1144608718 17:16690054-16690076 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1144608727 17:16690102-16690124 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1144904089 17:18625725-18625747 GGAGCTGCAGCGCCACCTGCAGG - Intergenic
1144904098 17:18625773-18625795 GGAGCTACAGCGCCACCTGCAGG - Intergenic
1144904107 17:18625821-18625843 GGAGCTGCAGCACCACCTGCAGG - Intergenic
1145128484 17:20320921-20320943 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1145128492 17:20320969-20320991 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1145128501 17:20321017-20321039 GGAGCTGCAGCGCGACGTGCAGG + Intergenic
1146459996 17:33038850-33038872 CTTGCTGCAGCGCCACCTACTGG - Intronic
1146793131 17:35764230-35764252 GCCGCAGCAGCGCCACCTGCTGG - Exonic
1146833347 17:36089251-36089273 GCTGCTTCAGCTACACCTCCCGG - Exonic
1146957666 17:36946244-36946266 CCTCCTGCTGCGCCTCCTGCGGG - Intergenic
1147522717 17:41189936-41189958 CCTGCTGCAGGACAACCTGCTGG + Exonic
1147526254 17:41226704-41226726 CCTGCTGCAGGACCACCTGCTGG + Exonic
1147526789 17:41232536-41232558 CCTGCTGCAGGACCACCTGCTGG + Exonic
1147527293 17:41238086-41238108 CGTGCTGCAGGACCACCTGCTGG + Exonic
1147528417 17:41249770-41249792 CCTGCTGCAGGACCACCTGCTGG + Exonic
1147528937 17:41255420-41255442 CCTGCTGCAGGACCACCTGCTGG + Exonic
1147530427 17:41271360-41271382 CCTGCTGCAGGACAACCTGCTGG + Intergenic
1147530838 17:41275732-41275754 CCTGCTGCAGGACCACCTGCTGG + Exonic
1147587824 17:41662807-41662829 GGAGCAGCAGCGCCCCCTGCCGG + Intergenic
1147612809 17:41811720-41811742 GCAGCCGCAGCGCCGCCTCCAGG + Exonic
1147672420 17:42184294-42184316 TCGGCTGCAGCGCCTCCTGCAGG - Exonic
1148178418 17:45586359-45586381 GCAGCAGCCGCGCCTCCTGCAGG - Intergenic
1148270741 17:46260096-46260118 GCAGCAGCCGCGCCTCCTGCAGG + Intergenic
1148336047 17:46841982-46842004 TCTGCAGGAGCGCCCCCTGCCGG - Intronic
1148437495 17:47694941-47694963 GCTCCTGCAGCCCGACCTGGGGG + Intronic
1148555816 17:48578021-48578043 GCTCCTGCGCCGCCACCCGCCGG - Exonic
1148838389 17:50478741-50478763 GGGGCTGCGGCGCCACCTGCCGG - Intergenic
1149169363 17:53791758-53791780 GCAGCTGTAGCTGCACCTGCAGG - Intergenic
1149263129 17:54900624-54900646 GCACCTGCAGCGCGCCCTGCGGG - Exonic
1149563813 17:57627922-57627944 GCTGCTCCAGCTCCAACTCCAGG + Intronic
1150293552 17:63995840-63995862 GCTGCTCCTGTGCCACCTTCTGG + Intergenic
1150624730 17:66834808-66834830 GAGGCTGCAGCCCCAGCTGCTGG + Intergenic
1151414574 17:73952904-73952926 GCCGCGGCCGCGCCCCCTGCCGG + Intergenic
1151477391 17:74351860-74351882 GCTGCTCCAGCGCCAGCTGCAGG - Exonic
1151573876 17:74941544-74941566 GCTGCTGCGGCGGGACCGGCAGG + Exonic
1151933398 17:77247183-77247205 GGGGAGGCAGCGCCACCTGCTGG + Intergenic
1151990800 17:77572736-77572758 GCTGCATCAGCCTCACCTGCAGG - Intergenic
1152099144 17:78290970-78290992 CCTGCTGCAGGGCCAGCTCCAGG + Intergenic
1152176860 17:78793518-78793540 GCAGCAGCAGGGCCACCTCCGGG + Intronic
1152947399 17:83205506-83205528 GCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1152947415 17:83205574-83205596 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1152947431 17:83205642-83205664 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1152947447 17:83205710-83205732 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1152947465 17:83205778-83205800 CCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1152947481 17:83205846-83205868 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1152947499 17:83205914-83205936 CCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1153043085 18:832355-832377 GCTGCTTCAGAGACACCAGCTGG + Intergenic
1153332573 18:3889012-3889034 CCTGCTGCAGCACCTCCTGAAGG - Intronic
1153571963 18:6482732-6482754 GCTGCCTCAGCACCATCTGCTGG + Intergenic
1154198538 18:12283350-12283372 GATGTCGCAGCGCCACCCGCAGG - Intergenic
1155212995 18:23619182-23619204 GCTGGTGCTGCGCCTCCTGCAGG - Intronic
1155259005 18:24023365-24023387 GCCGCTGCTGAGCCACATGCAGG + Intronic
1155264349 18:24076465-24076487 GCTGCTGGAGCGGCCCCTGTAGG + Intronic
1156036159 18:32770321-32770343 GCTGCTGCGGCGGCTGCTGCTGG + Exonic
1157565569 18:48676955-48676977 ATAGCAGCAGCGCCACCTGCTGG - Intronic
1157764351 18:50285754-50285776 GCTGCGCCAGTGCCAGCTGCGGG - Exonic
1158303846 18:56083138-56083160 GCTGGACCAGCGCCACCTGAAGG + Intergenic
1160164194 18:76495636-76495658 GCTGCTGCAGCCCCGGCTCCCGG + Exonic
1160218238 18:76952951-76952973 GCTGCTCCAACGCCACCAGCAGG - Intronic
1160299755 18:77668984-77669006 GCTGCTCCAGCCCCAGCTGCCGG + Intergenic
1160493166 18:79354765-79354787 GCTCCTTCAGCTCCAGCTGCTGG - Intronic
1160534992 18:79586945-79586967 CCTGCTGCCCCGGCACCTGCGGG + Intergenic
1160621141 18:80171397-80171419 GCTGCTGTGGCGCCCCCTGCTGG - Exonic
1160792617 19:929555-929577 GCTGTTGCAGCGGCAGCAGCGGG + Exonic
1160807930 19:1000773-1000795 GCTGCTGCAGCTGCACTTCCTGG + Exonic
1160810001 19:1009176-1009198 GCTGCTGCTGCTCCACCTCGGGG - Exonic
1160914033 19:1488247-1488269 GCCGCTGCAGCGTCTGCTGCTGG + Exonic
1160975034 19:1789016-1789038 CTTCCTGCAGCGCCTCCTGCTGG - Exonic
1161073486 19:2273874-2273896 CCGGCCGCAGCGCCACCTGCCGG + Intronic
1161155758 19:2731325-2731347 GCTGCAGCAGGGCCACCGGCCGG + Intronic
1161298554 19:3532008-3532030 GCGGCTGCAGGGCCACCGGCAGG + Exonic
1161506749 19:4648325-4648347 GCCGCTACACCGCCTCCTGCAGG + Intronic
1162105183 19:8365995-8366017 GCTGCTGCTGGGCCACCTTGTGG - Exonic
1162481107 19:10927692-10927714 GCTGCTGCTGCTGCTCCTGCAGG + Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162588278 19:11574898-11574920 CCTGCTGCAGCGCCACAGGTTGG + Exonic
1162738082 19:12757723-12757745 CTTCCTGCAGCGCCTCCTGCCGG + Exonic
1162739535 19:12766143-12766165 GGAGCTGCAGCGCCACCTGGAGG - Exonic
1162805465 19:13135931-13135953 GCTGCTGCCACCCCACCGGCTGG - Exonic
1162902716 19:13804973-13804995 GCAGCCGCAGCTCCACCTGGTGG - Exonic
1162923681 19:13918934-13918956 GCTGCTCCAGCGCCTCCAGCAGG - Exonic
1162926584 19:13933274-13933296 GTTGCTGCAGCACAACCAGCTGG - Exonic
1162955950 19:14097943-14097965 GGCTCTGCAGGGCCACCTGCTGG - Intronic
1163158752 19:15452683-15452705 GCAGCTGCGGGGCCAGCTGCAGG - Exonic
1163663252 19:18590847-18590869 ACTGCAGCAGGGCCACCTGGTGG - Exonic
1163725847 19:18922622-18922644 GCTGGACCAGCGCTACCTGCTGG + Exonic
1164541158 19:29122433-29122455 GCTGCTGCAGTGGGACCTGGTGG + Intergenic
1165490089 19:36118365-36118387 GCTCCAGCAGCACCACCTCCAGG - Intronic
1165856765 19:38883655-38883677 ACTGCGTCAGCGCCAGCTGCCGG - Exonic
1165861626 19:38912104-38912126 GCTGCTGCGGCTGCTCCTGCTGG - Exonic
1166719264 19:44988073-44988095 TCTCCAGCAGGGCCACCTGCAGG - Exonic
1166862174 19:45816875-45816897 GCTGCTGGGGCGGCAGCTGCAGG + Exonic
1166963419 19:46513628-46513650 GGTCCTGCAGCGCCCCCTGGTGG + Intronic
1167102909 19:47415062-47415084 GGTGCTGCGGTTCCACCTGCTGG - Exonic
1167203857 19:48086659-48086681 GCAGCTGGTGCTCCACCTGCTGG + Intronic
1167233074 19:48297503-48297525 GCTCCTGGAGCTCCACCTGCAGG + Exonic
1167272599 19:48514268-48514290 CCTGCTGCAGCCCCAGCTTCTGG - Intergenic
1167375070 19:49106832-49106854 CCAGCTGCAGCGCCACCTGCTGG + Intronic
1167509862 19:49890350-49890372 GCCGCTGCCCCGCCACATGCAGG - Exonic
1168269159 19:55240276-55240298 GCTGCAGCAGTGCCGCCTGGTGG - Exonic
1168324315 19:55530308-55530330 GCTGCGGGAGGCCCACCTGCGGG + Exonic
1168713402 19:58514071-58514093 GCTGCTGGAGCGCCACCTGGCGG - Exonic
926239403 2:11073453-11073475 GACGCTGCAGCGCCACCCACTGG - Intergenic
927957950 2:27221304-27221326 GCTGCTGCAGCCACTCATGCAGG - Exonic
928202218 2:29255246-29255268 GCTGCTCCAGCTTCATCTGCTGG + Intronic
929578478 2:43067626-43067648 GCTCCTGCAGCAGCTCCTGCTGG - Intergenic
930469629 2:51795680-51795702 CCTGGTGAAGCGCCACCTCCTGG + Intergenic
932412632 2:71556273-71556295 CCTGCAGCAGCGGCAGCTGCGGG + Intronic
932488959 2:72106285-72106307 GGTTCTGCAGGGCCAACTGCAGG - Intergenic
934966792 2:98730911-98730933 GCTGCGGGAGATCCACCTGCTGG - Intronic
935854037 2:107255929-107255951 GCTGCCTCTGCGCCTCCTGCTGG - Intergenic
936076063 2:109402569-109402591 GCTGCTGCAGTGGCCCTTGCTGG - Intronic
936661342 2:114547310-114547332 GCTGCTGCTGCTGCCCCTGCAGG + Intronic
937956063 2:127422426-127422448 GCTGCTGCGGCGGCTGCTGCTGG - Intronic
938392404 2:130916209-130916231 GCTGCTGCAGCACCGCCTTCGGG - Intronic
938770831 2:134499424-134499446 GCTGCTGCCTCCCAACCTGCAGG - Intronic
942465232 2:176201023-176201045 GCTGGTGCAGCACCAGCTGCTGG + Intergenic
943209014 2:184938733-184938755 GCAGCTGCAGCCGCAGCTGCAGG + Exonic
946109390 2:217401091-217401113 GCTGCTGCTGCTCTTCCTGCAGG - Intronic
946291677 2:218750125-218750147 GCTGCAGCAGCTCCACCACCAGG + Exonic
946322139 2:218960306-218960328 GCACCGGCGGCGCCACCTGCGGG - Exonic
946329935 2:219003232-219003254 TCTCCAGCAGCGCCTCCTGCAGG + Exonic
946416356 2:219541948-219541970 CCTGGCGCTGCGCCACCTGCTGG - Exonic
947593184 2:231396279-231396301 GCTGCGGGCGCTCCACCTGCCGG - Intronic
948412494 2:237774909-237774931 GCTGCTGTTACTCCACCTGCTGG + Intronic
948461339 2:238131306-238131328 GCTGCTGGAGTGCGACCTGCCGG + Exonic
948661298 2:239508144-239508166 GCTGCTGCAGCGCCCTGTGGCGG + Intergenic
948665896 2:239534800-239534822 GCTGGTGCAGCTGCACCCGCTGG + Intergenic
948686031 2:239670235-239670257 GCTCCTGCACAGCCACCTTCTGG - Intergenic
948843732 2:240672980-240673002 GCTGCAGCGGCGCCAGCTGCGGG - Intergenic
948850034 2:240701338-240701360 GCTGCTGCGGCGCCAGCCGCGGG + Intergenic
948911679 2:241008148-241008170 GCTGCTCCAGGGCCACCTGGGGG + Intronic
1168806182 20:673619-673641 GCGGGTGCAGAGCCACCAGCAGG - Intronic
1169245580 20:4022032-4022054 GCTGCTGCAGTGCTTCCTCCAGG + Intergenic
1169853346 20:10077252-10077274 TCCACTGCAGCGCCCCCTGCAGG + Intergenic
1170032216 20:11955549-11955571 GCTGCAGCAGCGTCACCTAATGG + Intergenic
1170801077 20:19590841-19590863 CCTGCTTCAGCTCCATCTGCAGG + Intronic
1170813361 20:19692794-19692816 GCGGACGCAGCGCCACCTGGTGG - Intronic
1171427496 20:25057945-25057967 GCTGCTGCTGCTGCAACTGCGGG + Exonic
1171891777 20:30724202-30724224 AGAGCTGCAGCCCCACCTGCCGG - Intergenic
1172993088 20:39050241-39050263 GGGGCTCCAGCGCCGCCTGCCGG - Intergenic
1174124950 20:48297458-48297480 GCTTCTGCAGCGTCTGCTGCAGG - Intergenic
1174481397 20:50833809-50833831 GCTCCTCCAGGACCACCTGCAGG - Intronic
1175754239 20:61519392-61519414 GCTGCAGCAGCTGCACATGCAGG + Intronic
1176105051 20:63381993-63382015 GTCCCTGCAGCACCACCTGCTGG + Intergenic
1176267782 20:64219792-64219814 GCTGCTGCAGCTGCTGCTGCTGG - Exonic
1176625403 21:9087773-9087795 AGAGCTGCAGCCCCACCTGCCGG + Intergenic
1176958999 21:15138716-15138738 GCTGCTGGAGACCCAGCTGCGGG + Intergenic
1177783000 21:25639854-25639876 GCTGCTGCTGCGCTACCTGGTGG + Exonic
1179810628 21:43866852-43866874 GCTGCTGCAGCGCGTCCCCCTGG - Intronic
1180222286 21:46366641-46366663 GCTGCTCCTGGGCCTCCTGCAGG - Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180859023 22:19066551-19066573 GACGGTGCAGAGCCACCTGCGGG - Intronic
1181030960 22:20148763-20148785 GCTGCTGCTGGGCGCCCTGCTGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181087709 22:20449982-20450004 GCTCCTCCTGAGCCACCTGCTGG + Intronic
1181104299 22:20564463-20564485 GCTGCTGCAGCGCCACCTGCTGG - Exonic
1181130545 22:20729085-20729107 GCTGCTGCAGCACCCCAGGCAGG + Intronic
1181309914 22:21939079-21939101 GCTGCTGCCCCGAGACCTGCTGG + Intronic
1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG + Intergenic
1182302040 22:29342368-29342390 GCAGCTGCAGCTGGACCTGCAGG + Exonic
1183027212 22:35074300-35074322 GCTGCTCCAGCCACACCCGCTGG - Intronic
1183303316 22:37069181-37069203 GCTGCTGCAGCTCGACCACCCGG - Exonic
1183506944 22:38214605-38214627 GCTTCTGCAGCTCCTCCTTCTGG - Exonic
1183715209 22:39529384-39529406 GGTCCTGCATCGCCATCTGCTGG + Exonic
1185221779 22:49632690-49632712 GGTGGCTCAGCGCCACCTGCCGG + Intronic
1185249059 22:49790009-49790031 TCTGCGGCAGCTCCACATGCAGG + Intronic
1185267219 22:49910713-49910735 GCTGCTGCAATGCCAGCTGACGG + Intronic
1185271135 22:49929699-49929721 GGTCCCACAGCGCCACCTGCTGG - Intergenic
1185335116 22:50267903-50267925 GCTTCTTCACCGCCACCTTCTGG + Exonic
1185346730 22:50313664-50313686 CCTGCTGCGGCGGCACCTCCTGG - Exonic
1185371197 22:50461688-50461710 GCTGCGGCCGCGCCTGCTGCCGG - Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
949947403 3:9201451-9201473 ACTGCAGCAGAGCCATCTGCTGG + Intronic
950020888 3:9787017-9787039 CCTGACGCAGCGCCTCCTGCAGG - Exonic
950668017 3:14509074-14509096 GCTCCTGGAGCGCCCCCTGCTGG - Intronic
951509517 3:23485973-23485995 GCTGGTGAAGCGACACCTGAAGG - Intronic
952301218 3:32106374-32106396 GCTCCCGCCGCGCCACATGCAGG - Intronic
952816471 3:37452033-37452055 GGCGCGGCAGCGCCCCCTGCGGG - Intergenic
953058231 3:39405296-39405318 GGAGCTGCAGAGCCACTTGCAGG + Intergenic
953377719 3:42442862-42442884 GCTGTGGCAGCGTCTCCTGCAGG + Intergenic
953880122 3:46687111-46687133 GCTGCCGCAGCGCCTTCCGCTGG + Exonic
954584641 3:51722518-51722540 GCCGCTTCATCGCCACCTGGGGG - Intergenic
954708704 3:52494546-52494568 CCAGGTGCAGGGCCACCTGCAGG + Intergenic
954805863 3:53220073-53220095 GAGCCTGCAGCGCCACCTGTAGG - Intergenic
955201519 3:56856046-56856068 TCTGCGGCAGGGCCCCCTGCTGG - Intronic
956603354 3:71047056-71047078 GCTGCTGAAAAGCCAACTGCTGG + Exonic
956892256 3:73624444-73624466 GCTGCTGCGGCGCGACGTGGAGG - Exonic
957518710 3:81290860-81290882 GGTTCTGCAGGGCCAGCTGCAGG - Intergenic
958932095 3:100217982-100218004 GCTGCTGCAGCTCCAAGTACTGG - Intergenic
960994419 3:123331612-123331634 GGTGCCACAGGGCCACCTGCAGG + Intronic
961286571 3:125810193-125810215 CCTACTGCAGCGCCACCTAGTGG + Intergenic
961382947 3:126507936-126507958 GCAGGTGCTGTGCCACCTGCTGG + Intronic
961464658 3:127073727-127073749 CCAGCTGCAGCCCCTCCTGCGGG - Intergenic
961863234 3:129934668-129934690 GGCTCTGCAGTGCCACCTGCAGG + Intergenic
961983608 3:131107604-131107626 GGTTCTGCAGGGCCAACTGCAGG - Intronic
963671591 3:148258380-148258402 GCTGCTTCAGCTCCAGCTGTGGG + Intergenic
967071739 3:185968368-185968390 GCTGCTGCAGTACCTACTGCAGG - Intergenic
968221419 3:196942824-196942846 ACTGCTGCAGGCCCAGCTGCGGG + Intergenic
968904721 4:3445947-3445969 CCCTCTGCAGCGCCTCCTGCCGG + Intronic
969610964 4:8227635-8227657 CCCGCCGCAGCGCCAGCTGCAGG - Exonic
969642758 4:8408988-8409010 TCTGCTGCAGAGCTGCCTGCTGG + Intronic
969659283 4:8517125-8517147 CCTGCTGCAGCCCCAGCAGCTGG - Intergenic
969725386 4:8915333-8915355 GCTGCAGCAGCGCCAGCTCAGGG + Intergenic
969802270 4:9578055-9578077 CCTACTGCAGCGCCACCTAGTGG + Intergenic
970758563 4:19455580-19455602 GCTGCCCCAGCTCCAGCTGCAGG + Intergenic
975072462 4:70158724-70158746 CCTGCTGCAGAGGCACCTGTTGG + Exonic
975072469 4:70158784-70158806 CCTGCTGCAGAGGCACCTGTTGG + Exonic
975409995 4:74038545-74038567 GGAGCAGCAGCGCCACCCGCAGG + Exonic
975415383 4:74099054-74099076 GGAGCAGCAGCGCCACCCGCAGG + Exonic
978478164 4:109156078-109156100 GGTGCTGTAGCTCCAACTGCAGG + Intronic
978503471 4:109433562-109433584 GCCGCCGCAGCGCCCCCTGCAGG - Intergenic
979582788 4:122379622-122379644 GCTGCTGCTGCGCCTCAGGCCGG - Intronic
980113207 4:128654341-128654363 GCTGCTGCAGCCCCACTTCTTGG + Intergenic
981810103 4:148764316-148764338 GTTGCTGCAGCTACACCAGCAGG - Intergenic
983124409 4:163932674-163932696 GGGGCTGCAGGTCCACCTGCAGG + Intronic
983672980 4:170259689-170259711 ATTCCTGCAGCGCCACCTACAGG + Intergenic
985425690 4:189828344-189828366 TCTGCTGCAGAGCCACCAGCTGG + Intergenic
987074108 5:14364780-14364802 CGTGCAGCTGCGCCACCTGCAGG + Exonic
994097333 5:95858894-95858916 CGGGGTGCAGCGCCACCTGCTGG - Exonic
996790755 5:127290707-127290729 GCTGCTGCAGCTGCTGCTGCCGG - Intergenic
997159596 5:131594170-131594192 GCTGCTCCAGCTCCATCTGGGGG + Intronic
997364733 5:133318722-133318744 GCTGCAGCAGGGCCACCTGAAGG + Intronic
997878189 5:137567632-137567654 GCTGCTGCACCTCCAGCTGACGG - Intronic
999408653 5:151329952-151329974 GGTTCTGCAGGGCCACCTGCAGG + Intronic
1001483977 5:172106590-172106612 GCAGGGGCAGGGCCACCTGCCGG - Intronic
1001844558 5:174910392-174910414 GCTGCTCTAGTGCCACCTGCAGG - Intergenic
1002135610 5:177105755-177105777 GCAGCTGCAGCTCCCACTGCGGG + Intergenic
1002424502 5:179167275-179167297 GCGGCAGCAGCGCCACCTGGTGG - Intronic
1002722774 5:181273541-181273563 CGGGCTGCAGCCCCACCTGCCGG - Intergenic
1002741280 5:181437192-181437214 TCTCCTGCAGCGCCGTCTGCTGG + Intergenic
1002741295 5:181437260-181437282 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1002741311 5:181437328-181437350 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1002741327 5:181437396-181437418 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1002741343 5:181437464-181437486 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1002741359 5:181437532-181437554 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1002741375 5:181437600-181437622 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1002741391 5:181437668-181437690 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1004203871 6:13574221-13574243 TCGGCTGCAGCGGCCCCTGCCGG - Intergenic
1004864310 6:19838063-19838085 GCGTCTCCAGCGCCAGCTGCAGG - Exonic
1005085217 6:21999401-21999423 GCTGCTGCAATGCCACTAGCAGG + Intergenic
1005313658 6:24583603-24583625 GTTGCGCCAGCGCCACCTGTAGG - Exonic
1005959522 6:30685724-30685746 GCTGCTGCTGCCGCTCCTGCCGG + Exonic
1005966600 6:30731016-30731038 GCTCCTGCACTGCCACCTGCTGG + Exonic
1006154236 6:32005706-32005728 GCTGCTGCTGCTGCCCCTGCTGG + Intergenic
1006155676 6:32011659-32011681 ACTGCTGCAGCGCGAGCTGATGG - Intergenic
1006160540 6:32038440-32038462 GCTGCTGCTGCTGCCCCTGCTGG + Exonic
1006162007 6:32044513-32044535 ACTGCTGCAGCGCGAGCTGATGG - Exonic
1006170150 6:32087746-32087768 GGACCTGGAGCGCCACCTGCGGG - Intronic
1006380320 6:33693479-33693501 GCCACTGCAGGGTCACCTGCTGG - Intronic
1006390736 6:33756886-33756908 GCAGCCCCACCGCCACCTGCGGG + Intergenic
1006421286 6:33935686-33935708 GCTGCAGCAGAGGCAGCTGCGGG + Intergenic
1006502960 6:34469677-34469699 GCTACCACAGAGCCACCTGCAGG - Intronic
1006518148 6:34555958-34555980 TCTGCTGCAGTGCCAACTTCAGG + Exonic
1006614965 6:35319948-35319970 GCTGCTGCTGGGCCTGCTGCAGG - Exonic
1006671577 6:35732577-35732599 GCCGCTGCAGCGTCACCCTCGGG + Intergenic
1007090803 6:39183763-39183785 GCTGCTGTAGTGCCACCTCAGGG + Intergenic
1007414794 6:41684982-41685004 GCTCCTGCTTCACCACCTGCTGG + Exonic
1007655729 6:43450040-43450062 GCTGCTGCAGAGCAGCCAGCAGG + Exonic
1007770017 6:44184690-44184712 GCTCCTGCAGTGCCACCTTTGGG - Intergenic
1011541718 6:88437546-88437568 GCTGCTGCTGTGGCATCTGCTGG - Intergenic
1011806281 6:91076071-91076093 GCTGCTGCAGCTCCTGCTGCTGG - Intergenic
1014391670 6:120872441-120872463 GCTGGTGAAGTGCCACCTTCAGG + Intergenic
1018237274 6:161738731-161738753 GATGCTGGACCCCCACCTGCAGG - Intronic
1018484109 6:164222961-164222983 GCTGCTCAGGTGCCACCTGCAGG - Intergenic
1018659967 6:166076834-166076856 CCTGGTGAAGCGCCACCTTCAGG - Intergenic
1018686322 6:166307482-166307504 GCTGCTGCACGGCGGCCTGCAGG - Exonic
1018792130 6:167156962-167156984 GCTTCTCCAGCCCCACCTTCAGG - Exonic
1019246396 6:170712889-170712911 TCTCCGGCAGCGCCGCCTGCTGG + Intergenic
1019246413 6:170712957-170712979 CCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1019246429 6:170713025-170713047 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1019246445 6:170713093-170713115 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1019246461 6:170713161-170713183 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1019246477 6:170713229-170713251 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1019246493 6:170713297-170713319 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1019246509 6:170713365-170713387 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1019246525 6:170713433-170713455 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1019388989 7:774671-774693 GCAGCATCAGCGCCACCTCCTGG + Intronic
1019509980 7:1412957-1412979 AACGCCGCAGCGCCACCTGCCGG + Intergenic
1019511078 7:1417610-1417632 TCTGCTCCAGCTCCACCTCCAGG - Intergenic
1019527348 7:1486735-1486757 GCAGCTGCTGGGCCGCCTGCAGG - Exonic
1019780037 7:2934369-2934391 GCTGCCCCATCGCCGCCTGCAGG + Intronic
1020116164 7:5477778-5477800 GCTGCCACAGCGCTGCCTGCTGG + Intronic
1020117969 7:5487051-5487073 GGAGCCCCAGCGCCACCTGCTGG + Intronic
1020275454 7:6622056-6622078 GCAGCTGCAGCTCAAACTGCAGG + Exonic
1021615639 7:22500246-22500268 GCGCGTCCAGCGCCACCTGCTGG + Exonic
1021668749 7:23013932-23013954 GCTGCCGGAGCTCCACCTGCAGG + Exonic
1022094551 7:27130562-27130584 GCTGCTGCAGCGGCAGGTGCTGG + Exonic
1022547149 7:31200191-31200213 ACTGCTGCTGTGGCACCTGCTGG - Intergenic
1023382587 7:39623578-39623600 GCTGCTGCAGAGCCGCCAGGAGG + Exonic
1024043936 7:45574882-45574904 GCTGCAGCTGGGGCACCTGCAGG - Exonic
1026116168 7:67497572-67497594 TCTGCTCCAGCCCCACCAGCTGG + Intergenic
1026595848 7:71733444-71733466 GATGCTCTAGCGCCCCCTGCTGG + Intergenic
1026806809 7:73434034-73434056 GCTGCTGCTGTGGCAGCTGCTGG + Exonic
1026913635 7:74107003-74107025 GATGCTGCAGCTCCTCCTGGGGG - Exonic
1027374580 7:77537365-77537387 GCGGCTGCGGCGGCACCGGCTGG - Exonic
1028376860 7:90154389-90154411 GCGCGTCCAGCGCCACCTGCTGG - Exonic
1029070464 7:97891936-97891958 CCTACTGCAGCGCCACCTAGTGG - Intergenic
1029701403 7:102248858-102248880 GCAGCAGCAGCGCCCCCCGCAGG + Exonic
1030047368 7:105509595-105509617 GCTGCTGTAGTCCCAGCTGCTGG - Intronic
1030855860 7:114556376-114556398 GCTGCTGCTGCTTCCCCTGCAGG + Intronic
1031918200 7:127582646-127582668 GCTGCAGCAGCTCCACCGGCAGG - Exonic
1032003444 7:128281762-128281784 GCTGCTGCAGGCCCAGCTGAGGG + Intergenic
1032085869 7:128883756-128883778 CGCCCTGCAGCGCCACCTGCTGG + Intronic
1032160080 7:129502988-129503010 GCGGCTGCTGCGCCCCCAGCAGG - Intronic
1032495921 7:132362232-132362254 TTTGCTGTAGAGCCACCTGCAGG + Intronic
1034426802 7:151018305-151018327 GCAGCAGCTGCGCCATCTGCCGG + Exonic
1034429440 7:151033875-151033897 GTTTCTGCACCCCCACCTGCTGG + Exonic
1034462291 7:151204616-151204638 GCGGCTGCTGCGACGCCTGCTGG - Exonic
1034998141 7:155591372-155591394 GCTGCTTCTGAGCCACCTCCAGG + Intergenic
1035337700 7:158140669-158140691 CCTGCCCCAGCCCCACCTGCAGG - Intronic
1035361556 7:158316831-158316853 GCTTCTGCAACGCCACGCGCAGG + Exonic
1035501614 8:94528-94550 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
1035501630 8:94596-94618 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
1035501646 8:94664-94686 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
1035501662 8:94732-94754 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
1035501677 8:94800-94822 TCTCCTGCAGCGCCGCCTGCTGG - Intergenic
1036091310 8:5668680-5668702 GCTGCTGGAGCTAAACCTGCAGG + Intergenic
1036210924 8:6840809-6840831 GGTGCAACAGCGCCACCTACTGG - Intergenic
1036364789 8:8110903-8110925 CCTACTGCAGCGCCACCTAGTGG + Intergenic
1036886148 8:12555208-12555230 CCTACTGCAGCGCCACCTAGTGG - Intergenic
1036893764 8:12614296-12614318 CCTACTGCAGCGCCACCTAGTGG - Intergenic
1037387785 8:18361896-18361918 GCATCTGCAGTGCCACCTCCTGG - Intergenic
1037581807 8:20249814-20249836 GCTGCTGCAGGGCCTTCTCCAGG + Exonic
1039476984 8:37844155-37844177 ACTGCTGCGGCTCCTCCTGCAGG - Exonic
1040727353 8:50398336-50398358 TCTCCTGCAGCGGCCCCTGCTGG + Intronic
1044934399 8:97278937-97278959 GCTTCTGCAGTGCCACGTGGAGG - Intergenic
1048608141 8:135991461-135991483 GCTGCTCCATCTCCTCCTGCTGG + Intergenic
1048861720 8:138728757-138728779 GCTGCTGCAGATACACCTGGAGG + Intronic
1049052386 8:140208920-140208942 GGTTCTGCAGGGCCAACTGCAGG + Intronic
1049312965 8:141943118-141943140 GCTGTGCCAGCGGCACCTGCAGG - Intergenic
1049419247 8:142509777-142509799 GCTGCAGGAGCCCCAGCTGCTGG - Intronic
1049509779 8:143021744-143021766 GCTGCTGCTGAGCCTGCTGCCGG + Exonic
1049584405 8:143426226-143426248 GCTGCAGCAGCCCCTCCTGAAGG + Intronic
1049616462 8:143577724-143577746 CCTGCAGGAGCGGCACCTGCGGG + Exonic
1049782845 8:144436651-144436673 ACTGCTGCAGCGTCTCCAGCGGG + Exonic
1049789892 8:144467710-144467732 GCTGCTTCAGCTCCTCCAGCTGG - Exonic
1049791820 8:144475739-144475761 GCCGCTGCAGGGCCCCATGCGGG + Exonic
1053656617 9:40223048-40223070 AGAGCTGCAGCCCCACCTGCTGG + Intergenic
1053906972 9:42852270-42852292 AGAGCTGCAGCCCCACCTGCCGG + Intergenic
1054368723 9:64369270-64369292 AGAGCTGCAGCCCCACCTGCTGG + Intergenic
1054527995 9:66153237-66153259 GGAGCTGCAGCCCCACCTGCTGG - Intergenic
1054676350 9:67859022-67859044 AGAGCTGCAGCCCCACCTGCTGG + Intergenic
1054877394 9:70111157-70111179 TCTGGTGGAGCGCCACCTGCTGG + Intronic
1055082874 9:72284440-72284462 GCTGCTGCTGTGGGACCTGCTGG + Intergenic
1056186103 9:84136567-84136589 GCTGCATCAGCTTCACCTGCTGG + Intergenic
1056557636 9:87703106-87703128 ACTGCTGCAGCGACATCAGCTGG - Exonic
1056598267 9:88025573-88025595 GCTGCCAGAGTGCCACCTGCTGG - Intergenic
1057130108 9:92649012-92649034 GCTGCAGGAGCCCCATCTGCAGG - Intronic
1057152451 9:92807936-92807958 GCTGCAGCGGTGCCAGCTGCAGG + Intergenic
1057177405 9:93010269-93010291 GACGCTGCAGCACCACATGCTGG + Exonic
1058792831 9:108468525-108468547 TCTCTTTCAGCGCCACCTGCTGG - Intergenic
1058826114 9:108777423-108777445 GCTGCAGGCTCGCCACCTGCAGG - Intergenic
1060480623 9:124015039-124015061 GCAGCAGCAGCGGCACCTGGAGG + Intronic
1060514819 9:124258805-124258827 GCTGCGGCAGGGCCACTGGCAGG + Intronic
1060586624 9:124790630-124790652 CCTCCTCCAGCCCCACCTGCCGG - Intronic
1060819371 9:126652432-126652454 GCGGCCGCACCCCCACCTGCAGG - Intronic
1060838745 9:126777920-126777942 GCTGCAGCAGCACCACCTCCAGG + Intergenic
1060859306 9:126940782-126940804 GGTGCTGCAGCACCACCTGGTGG - Intronic
1060938383 9:127528918-127528940 GCTTCTGCACAGCCTCCTGCTGG - Intronic
1060965912 9:127712220-127712242 CCTGCTGCTGCTCCAGCTGCAGG - Exonic
1061193531 9:129095408-129095430 CCTGCTGCAGAGCCACCCCCGGG - Exonic
1061610070 9:131740112-131740134 ACGGCCACAGCGCCACCTGCCGG + Intergenic
1061672181 9:132194863-132194885 GCTGCTGCAGTGGCACCTGGTGG + Intronic
1061681288 9:132243611-132243633 GCTGCCACTGCTCCACCTGCAGG + Exonic
1061968863 9:134032734-134032756 GCTGCTGCCGCGCCACCCTTGGG - Exonic
1062185149 9:135214277-135214299 GCTGGTGCAGGGCCCACTGCAGG + Intergenic
1062462483 9:136667718-136667740 GCAGCTGCTGGCCCACCTGCTGG + Intronic
1203748575 Un_GL000218v1:58234-58256 AGAGCTGCAGCCCCACCTGCCGG + Intergenic
1203607159 Un_KI270748v1:68272-68294 TCTCCTGCAGCGCCGTCTGCTGG + Intergenic
1203607174 Un_KI270748v1:68340-68362 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1203607190 Un_KI270748v1:68408-68430 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1203607206 Un_KI270748v1:68476-68498 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1203607222 Un_KI270748v1:68544-68566 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1203607238 Un_KI270748v1:68612-68634 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1203607254 Un_KI270748v1:68680-68702 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1203607270 Un_KI270748v1:68748-68770 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1203607286 Un_KI270748v1:68816-68838 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1203607302 Un_KI270748v1:68884-68906 TCTCCTGCAGCGCCGCCTGCTGG + Intergenic
1185893112 X:3837398-3837420 GTAGCAGCAGCGCCACCAGCCGG + Intronic
1185898224 X:3875820-3875842 GTAGCAGCAGCGCCACCAGCCGG + Intergenic
1185903339 X:3914249-3914271 GTAGCAGCAGCGCCACCAGCCGG + Intergenic
1187267661 X:17750272-17750294 GCTTCTGCAGCACCACCTTCAGG + Exonic
1187507252 X:19887727-19887749 GCTCCTGCAGCTCCGCCTGCCGG + Intergenic
1187572530 X:20519365-20519387 GCAGCTTCAGCCTCACCTGCTGG - Intergenic
1188071352 X:25721749-25721771 GCAGCAGCAGCGCCATCTTCTGG - Intergenic
1188835457 X:34948713-34948735 GCTGCTGCAGCAGCTGCTGCTGG + Intergenic
1190781155 X:53596931-53596953 GTTGCTGCAGCTACACCAGCAGG + Intronic
1192252510 X:69424350-69424372 ACTACAGCAGCACCACCTGCAGG - Intergenic
1192263429 X:69523058-69523080 GCGGCTGCAGCTCCAGCTGCTGG + Intronic
1195111626 X:101656630-101656652 GCTGCTGCAGCCCCATCTCCAGG + Exonic
1196719424 X:118839663-118839685 GCCGCTGCAGCCCCACCGTCCGG - Intergenic
1198707612 X:139465684-139465706 GCTGCTGCTGCTTCTCCTGCTGG - Intergenic
1200068831 X:153517964-153517986 CCTGCCGCCGCACCACCTGCCGG - Intronic
1200119207 X:153782533-153782555 GCTCCTCCAGCGCCACCTCTAGG + Intronic
1200161880 X:154013789-154013811 GCTGCTGCCGCGCCCCCTGCTGG - Intronic
1200252966 X:154563630-154563652 GCTGCTCCAGCTGCTCCTGCAGG - Exonic
1200264801 X:154640785-154640807 GCTGCTCCAGCTGCTCCTGCAGG + Intergenic
1200418402 Y:2936093-2936115 CCTGCGGCAGCGCCACCTTTCGG + Intronic
1201161922 Y:11173204-11173226 AGAGCTGCAGCCCCACCTGCCGG + Intergenic