ID: 1181121453

View in Genome Browser
Species Human (GRCh38)
Location 22:20670401-20670423
Sequence CCCAAGAGGGGACCAAGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181121453_1181121461 3 Left 1181121453 22:20670401-20670423 CCCCGGCTTGGTCCCCTCTTGGG No data
Right 1181121461 22:20670427-20670449 GCCCAGGCTGAGCTGCCCCCAGG No data
1181121453_1181121466 18 Left 1181121453 22:20670401-20670423 CCCCGGCTTGGTCCCCTCTTGGG No data
Right 1181121466 22:20670442-20670464 CCCCCAGGGTCGCCCTCACCTGG No data
1181121453_1181121471 27 Left 1181121453 22:20670401-20670423 CCCCGGCTTGGTCCCCTCTTGGG No data
Right 1181121471 22:20670451-20670473 TCGCCCTCACCTGGTGCGCAGGG No data
1181121453_1181121463 4 Left 1181121453 22:20670401-20670423 CCCCGGCTTGGTCCCCTCTTGGG No data
Right 1181121463 22:20670428-20670450 CCCAGGCTGAGCTGCCCCCAGGG No data
1181121453_1181121470 26 Left 1181121453 22:20670401-20670423 CCCCGGCTTGGTCCCCTCTTGGG No data
Right 1181121470 22:20670450-20670472 GTCGCCCTCACCTGGTGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181121453 Original CRISPR CCCAAGAGGGGACCAAGCCG GGG (reversed) Intergenic