ID: 1181121458

View in Genome Browser
Species Human (GRCh38)
Location 22:20670413-20670435
Sequence AGCCTGGGCACACCCAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181121458_1181121475 24 Left 1181121458 22:20670413-20670435 CCCCTCTTGGGTGTGCCCAGGCT No data
Right 1181121475 22:20670460-20670482 CCTGGTGCGCAGGGCCTGCCAGG No data
1181121458_1181121471 15 Left 1181121458 22:20670413-20670435 CCCCTCTTGGGTGTGCCCAGGCT No data
Right 1181121471 22:20670451-20670473 TCGCCCTCACCTGGTGCGCAGGG No data
1181121458_1181121461 -9 Left 1181121458 22:20670413-20670435 CCCCTCTTGGGTGTGCCCAGGCT No data
Right 1181121461 22:20670427-20670449 GCCCAGGCTGAGCTGCCCCCAGG No data
1181121458_1181121470 14 Left 1181121458 22:20670413-20670435 CCCCTCTTGGGTGTGCCCAGGCT No data
Right 1181121470 22:20670450-20670472 GTCGCCCTCACCTGGTGCGCAGG No data
1181121458_1181121466 6 Left 1181121458 22:20670413-20670435 CCCCTCTTGGGTGTGCCCAGGCT No data
Right 1181121466 22:20670442-20670464 CCCCCAGGGTCGCCCTCACCTGG No data
1181121458_1181121463 -8 Left 1181121458 22:20670413-20670435 CCCCTCTTGGGTGTGCCCAGGCT No data
Right 1181121463 22:20670428-20670450 CCCAGGCTGAGCTGCCCCCAGGG No data
1181121458_1181121476 27 Left 1181121458 22:20670413-20670435 CCCCTCTTGGGTGTGCCCAGGCT No data
Right 1181121476 22:20670463-20670485 GGTGCGCAGGGCCTGCCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181121458 Original CRISPR AGCCTGGGCACACCCAAGAG GGG (reversed) Intergenic