ID: 1181121460

View in Genome Browser
Species Human (GRCh38)
Location 22:20670415-20670437
Sequence TCAGCCTGGGCACACCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181121460_1181121463 -10 Left 1181121460 22:20670415-20670437 CCTCTTGGGTGTGCCCAGGCTGA No data
Right 1181121463 22:20670428-20670450 CCCAGGCTGAGCTGCCCCCAGGG No data
1181121460_1181121471 13 Left 1181121460 22:20670415-20670437 CCTCTTGGGTGTGCCCAGGCTGA No data
Right 1181121471 22:20670451-20670473 TCGCCCTCACCTGGTGCGCAGGG No data
1181121460_1181121476 25 Left 1181121460 22:20670415-20670437 CCTCTTGGGTGTGCCCAGGCTGA No data
Right 1181121476 22:20670463-20670485 GGTGCGCAGGGCCTGCCAGGCGG No data
1181121460_1181121466 4 Left 1181121460 22:20670415-20670437 CCTCTTGGGTGTGCCCAGGCTGA No data
Right 1181121466 22:20670442-20670464 CCCCCAGGGTCGCCCTCACCTGG No data
1181121460_1181121470 12 Left 1181121460 22:20670415-20670437 CCTCTTGGGTGTGCCCAGGCTGA No data
Right 1181121470 22:20670450-20670472 GTCGCCCTCACCTGGTGCGCAGG No data
1181121460_1181121475 22 Left 1181121460 22:20670415-20670437 CCTCTTGGGTGTGCCCAGGCTGA No data
Right 1181121475 22:20670460-20670482 CCTGGTGCGCAGGGCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181121460 Original CRISPR TCAGCCTGGGCACACCCAAG AGG (reversed) Intergenic