ID: 1181121461

View in Genome Browser
Species Human (GRCh38)
Location 22:20670427-20670449
Sequence GCCCAGGCTGAGCTGCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181121455_1181121461 2 Left 1181121455 22:20670402-20670424 CCCGGCTTGGTCCCCTCTTGGGT No data
Right 1181121461 22:20670427-20670449 GCCCAGGCTGAGCTGCCCCCAGG No data
1181121458_1181121461 -9 Left 1181121458 22:20670413-20670435 CCCCTCTTGGGTGTGCCCAGGCT No data
Right 1181121461 22:20670427-20670449 GCCCAGGCTGAGCTGCCCCCAGG No data
1181121441_1181121461 25 Left 1181121441 22:20670379-20670401 CCAGGGAAGCCCGCCCCCCGGCC No data
Right 1181121461 22:20670427-20670449 GCCCAGGCTGAGCTGCCCCCAGG No data
1181121447_1181121461 11 Left 1181121447 22:20670393-20670415 CCCCCGGCCCCCGGCTTGGTCCC No data
Right 1181121461 22:20670427-20670449 GCCCAGGCTGAGCTGCCCCCAGG No data
1181121440_1181121461 26 Left 1181121440 22:20670378-20670400 CCCAGGGAAGCCCGCCCCCCGGC No data
Right 1181121461 22:20670427-20670449 GCCCAGGCTGAGCTGCCCCCAGG No data
1181121446_1181121461 12 Left 1181121446 22:20670392-20670414 CCCCCCGGCCCCCGGCTTGGTCC No data
Right 1181121461 22:20670427-20670449 GCCCAGGCTGAGCTGCCCCCAGG No data
1181121438_1181121461 29 Left 1181121438 22:20670375-20670397 CCTCCCAGGGAAGCCCGCCCCCC No data
Right 1181121461 22:20670427-20670449 GCCCAGGCTGAGCTGCCCCCAGG No data
1181121456_1181121461 1 Left 1181121456 22:20670403-20670425 CCGGCTTGGTCCCCTCTTGGGTG No data
Right 1181121461 22:20670427-20670449 GCCCAGGCTGAGCTGCCCCCAGG No data
1181121443_1181121461 16 Left 1181121443 22:20670388-20670410 CCCGCCCCCCGGCCCCCGGCTTG No data
Right 1181121461 22:20670427-20670449 GCCCAGGCTGAGCTGCCCCCAGG No data
1181121448_1181121461 10 Left 1181121448 22:20670394-20670416 CCCCGGCCCCCGGCTTGGTCCCC No data
Right 1181121461 22:20670427-20670449 GCCCAGGCTGAGCTGCCCCCAGG No data
1181121444_1181121461 15 Left 1181121444 22:20670389-20670411 CCGCCCCCCGGCCCCCGGCTTGG No data
Right 1181121461 22:20670427-20670449 GCCCAGGCTGAGCTGCCCCCAGG No data
1181121449_1181121461 9 Left 1181121449 22:20670395-20670417 CCCGGCCCCCGGCTTGGTCCCCT No data
Right 1181121461 22:20670427-20670449 GCCCAGGCTGAGCTGCCCCCAGG No data
1181121453_1181121461 3 Left 1181121453 22:20670401-20670423 CCCCGGCTTGGTCCCCTCTTGGG No data
Right 1181121461 22:20670427-20670449 GCCCAGGCTGAGCTGCCCCCAGG No data
1181121451_1181121461 4 Left 1181121451 22:20670400-20670422 CCCCCGGCTTGGTCCCCTCTTGG No data
Right 1181121461 22:20670427-20670449 GCCCAGGCTGAGCTGCCCCCAGG No data
1181121459_1181121461 -10 Left 1181121459 22:20670414-20670436 CCCTCTTGGGTGTGCCCAGGCTG No data
Right 1181121461 22:20670427-20670449 GCCCAGGCTGAGCTGCCCCCAGG No data
1181121450_1181121461 8 Left 1181121450 22:20670396-20670418 CCGGCCCCCGGCTTGGTCCCCTC No data
Right 1181121461 22:20670427-20670449 GCCCAGGCTGAGCTGCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181121461 Original CRISPR GCCCAGGCTGAGCTGCCCCC AGG Intergenic