ID: 1181121466

View in Genome Browser
Species Human (GRCh38)
Location 22:20670442-20670464
Sequence CCCCCAGGGTCGCCCTCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181121446_1181121466 27 Left 1181121446 22:20670392-20670414 CCCCCCGGCCCCCGGCTTGGTCC No data
Right 1181121466 22:20670442-20670464 CCCCCAGGGTCGCCCTCACCTGG No data
1181121462_1181121466 -9 Left 1181121462 22:20670428-20670450 CCCAGGCTGAGCTGCCCCCAGGG No data
Right 1181121466 22:20670442-20670464 CCCCCAGGGTCGCCCTCACCTGG No data
1181121455_1181121466 17 Left 1181121455 22:20670402-20670424 CCCGGCTTGGTCCCCTCTTGGGT No data
Right 1181121466 22:20670442-20670464 CCCCCAGGGTCGCCCTCACCTGG No data
1181121451_1181121466 19 Left 1181121451 22:20670400-20670422 CCCCCGGCTTGGTCCCCTCTTGG No data
Right 1181121466 22:20670442-20670464 CCCCCAGGGTCGCCCTCACCTGG No data
1181121444_1181121466 30 Left 1181121444 22:20670389-20670411 CCGCCCCCCGGCCCCCGGCTTGG No data
Right 1181121466 22:20670442-20670464 CCCCCAGGGTCGCCCTCACCTGG No data
1181121460_1181121466 4 Left 1181121460 22:20670415-20670437 CCTCTTGGGTGTGCCCAGGCTGA No data
Right 1181121466 22:20670442-20670464 CCCCCAGGGTCGCCCTCACCTGG No data
1181121458_1181121466 6 Left 1181121458 22:20670413-20670435 CCCCTCTTGGGTGTGCCCAGGCT No data
Right 1181121466 22:20670442-20670464 CCCCCAGGGTCGCCCTCACCTGG No data
1181121464_1181121466 -10 Left 1181121464 22:20670429-20670451 CCAGGCTGAGCTGCCCCCAGGGT No data
Right 1181121466 22:20670442-20670464 CCCCCAGGGTCGCCCTCACCTGG No data
1181121447_1181121466 26 Left 1181121447 22:20670393-20670415 CCCCCGGCCCCCGGCTTGGTCCC No data
Right 1181121466 22:20670442-20670464 CCCCCAGGGTCGCCCTCACCTGG No data
1181121450_1181121466 23 Left 1181121450 22:20670396-20670418 CCGGCCCCCGGCTTGGTCCCCTC No data
Right 1181121466 22:20670442-20670464 CCCCCAGGGTCGCCCTCACCTGG No data
1181121448_1181121466 25 Left 1181121448 22:20670394-20670416 CCCCGGCCCCCGGCTTGGTCCCC No data
Right 1181121466 22:20670442-20670464 CCCCCAGGGTCGCCCTCACCTGG No data
1181121456_1181121466 16 Left 1181121456 22:20670403-20670425 CCGGCTTGGTCCCCTCTTGGGTG No data
Right 1181121466 22:20670442-20670464 CCCCCAGGGTCGCCCTCACCTGG No data
1181121459_1181121466 5 Left 1181121459 22:20670414-20670436 CCCTCTTGGGTGTGCCCAGGCTG No data
Right 1181121466 22:20670442-20670464 CCCCCAGGGTCGCCCTCACCTGG No data
1181121449_1181121466 24 Left 1181121449 22:20670395-20670417 CCCGGCCCCCGGCTTGGTCCCCT No data
Right 1181121466 22:20670442-20670464 CCCCCAGGGTCGCCCTCACCTGG No data
1181121453_1181121466 18 Left 1181121453 22:20670401-20670423 CCCCGGCTTGGTCCCCTCTTGGG No data
Right 1181121466 22:20670442-20670464 CCCCCAGGGTCGCCCTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181121466 Original CRISPR CCCCCAGGGTCGCCCTCACC TGG Intergenic