ID: 1181121470

View in Genome Browser
Species Human (GRCh38)
Location 22:20670450-20670472
Sequence GTCGCCCTCACCTGGTGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181121453_1181121470 26 Left 1181121453 22:20670401-20670423 CCCCGGCTTGGTCCCCTCTTGGG No data
Right 1181121470 22:20670450-20670472 GTCGCCCTCACCTGGTGCGCAGG No data
1181121456_1181121470 24 Left 1181121456 22:20670403-20670425 CCGGCTTGGTCCCCTCTTGGGTG No data
Right 1181121470 22:20670450-20670472 GTCGCCCTCACCTGGTGCGCAGG No data
1181121459_1181121470 13 Left 1181121459 22:20670414-20670436 CCCTCTTGGGTGTGCCCAGGCTG No data
Right 1181121470 22:20670450-20670472 GTCGCCCTCACCTGGTGCGCAGG No data
1181121458_1181121470 14 Left 1181121458 22:20670413-20670435 CCCCTCTTGGGTGTGCCCAGGCT No data
Right 1181121470 22:20670450-20670472 GTCGCCCTCACCTGGTGCGCAGG No data
1181121460_1181121470 12 Left 1181121460 22:20670415-20670437 CCTCTTGGGTGTGCCCAGGCTGA No data
Right 1181121470 22:20670450-20670472 GTCGCCCTCACCTGGTGCGCAGG No data
1181121451_1181121470 27 Left 1181121451 22:20670400-20670422 CCCCCGGCTTGGTCCCCTCTTGG No data
Right 1181121470 22:20670450-20670472 GTCGCCCTCACCTGGTGCGCAGG No data
1181121455_1181121470 25 Left 1181121455 22:20670402-20670424 CCCGGCTTGGTCCCCTCTTGGGT No data
Right 1181121470 22:20670450-20670472 GTCGCCCTCACCTGGTGCGCAGG No data
1181121464_1181121470 -2 Left 1181121464 22:20670429-20670451 CCAGGCTGAGCTGCCCCCAGGGT No data
Right 1181121470 22:20670450-20670472 GTCGCCCTCACCTGGTGCGCAGG No data
1181121462_1181121470 -1 Left 1181121462 22:20670428-20670450 CCCAGGCTGAGCTGCCCCCAGGG No data
Right 1181121470 22:20670450-20670472 GTCGCCCTCACCTGGTGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181121470 Original CRISPR GTCGCCCTCACCTGGTGCGC AGG Intergenic