ID: 1181124009

View in Genome Browser
Species Human (GRCh38)
Location 22:20691221-20691243
Sequence GCTGAGGCCCAGAAATGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181124009_1181124010 -8 Left 1181124009 22:20691221-20691243 CCTTCACATTTCTGGGCCTCAGC No data
Right 1181124010 22:20691236-20691258 GCCTCAGCCACAGCTGCAGCAGG No data
1181124009_1181124013 2 Left 1181124009 22:20691221-20691243 CCTTCACATTTCTGGGCCTCAGC No data
Right 1181124013 22:20691246-20691268 CAGCTGCAGCAGGTGCCCAGAGG No data
1181124009_1181124016 30 Left 1181124009 22:20691221-20691243 CCTTCACATTTCTGGGCCTCAGC No data
Right 1181124016 22:20691274-20691296 ACCAGAGATCCCAGACCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181124009 Original CRISPR GCTGAGGCCCAGAAATGTGA AGG (reversed) Intergenic
No off target data available for this crispr