ID: 1181124535

View in Genome Browser
Species Human (GRCh38)
Location 22:20694458-20694480
Sequence CTGTGTCAGGGAAATGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181124519_1181124535 28 Left 1181124519 22:20694407-20694429 CCTGCTGCTGCCACGGGCCCTGT No data
Right 1181124535 22:20694458-20694480 CTGTGTCAGGGAAATGATCATGG No data
1181124525_1181124535 -1 Left 1181124525 22:20694436-20694458 CCAGGACGTCCCCCCACCCTCGC No data
Right 1181124535 22:20694458-20694480 CTGTGTCAGGGAAATGATCATGG No data
1181124524_1181124535 0 Left 1181124524 22:20694435-20694457 CCCAGGACGTCCCCCCACCCTCG No data
Right 1181124535 22:20694458-20694480 CTGTGTCAGGGAAATGATCATGG No data
1181124520_1181124535 18 Left 1181124520 22:20694417-20694439 CCACGGGCCCTGTCTCTACCCAG No data
Right 1181124535 22:20694458-20694480 CTGTGTCAGGGAAATGATCATGG No data
1181124523_1181124535 10 Left 1181124523 22:20694425-20694447 CCTGTCTCTACCCAGGACGTCCC 0: 10
1: 2
2: 1
3: 166
4: 395
Right 1181124535 22:20694458-20694480 CTGTGTCAGGGAAATGATCATGG No data
1181124526_1181124535 -10 Left 1181124526 22:20694445-20694467 CCCCCCACCCTCGCTGTGTCAGG No data
Right 1181124535 22:20694458-20694480 CTGTGTCAGGGAAATGATCATGG No data
1181124522_1181124535 11 Left 1181124522 22:20694424-20694446 CCCTGTCTCTACCCAGGACGTCC 0: 9
1: 2
2: 3
3: 18
4: 162
Right 1181124535 22:20694458-20694480 CTGTGTCAGGGAAATGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181124535 Original CRISPR CTGTGTCAGGGAAATGATCA TGG Intergenic
No off target data available for this crispr