ID: 1181126215

View in Genome Browser
Species Human (GRCh38)
Location 22:20703623-20703645
Sequence TCTGCAGCGCGTCCTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181126215_1181126226 25 Left 1181126215 22:20703623-20703645 CCACACCCAGGACGCGCTGCAGA No data
Right 1181126226 22:20703671-20703693 GGAGCAGACCGTAGTCCTGCAGG No data
1181126215_1181126222 4 Left 1181126215 22:20703623-20703645 CCACACCCAGGACGCGCTGCAGA No data
Right 1181126222 22:20703650-20703672 GGAGGCCTGGGCCATATTCCAGG No data
1181126215_1181126221 -8 Left 1181126215 22:20703623-20703645 CCACACCCAGGACGCGCTGCAGA No data
Right 1181126221 22:20703638-20703660 GCTGCAGACAGCGGAGGCCTGGG No data
1181126215_1181126220 -9 Left 1181126215 22:20703623-20703645 CCACACCCAGGACGCGCTGCAGA No data
Right 1181126220 22:20703637-20703659 CGCTGCAGACAGCGGAGGCCTGG No data
1181126215_1181126227 30 Left 1181126215 22:20703623-20703645 CCACACCCAGGACGCGCTGCAGA No data
Right 1181126227 22:20703676-20703698 AGACCGTAGTCCTGCAGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181126215 Original CRISPR TCTGCAGCGCGTCCTGGGTG TGG (reversed) Intergenic
No off target data available for this crispr