ID: 1181127277

View in Genome Browser
Species Human (GRCh38)
Location 22:20709573-20709595
Sequence GGGGCCACTCAGGTGATGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 2, 1: 1, 2: 2, 3: 11, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181127277_1181127287 2 Left 1181127277 22:20709573-20709595 CCCAGCATCACCTGAGTGGCCCC 0: 2
1: 1
2: 2
3: 11
4: 159
Right 1181127287 22:20709598-20709620 GGCATTAGGGGACTAAGCATTGG 0: 2
1: 1
2: 2
3: 10
4: 368
1181127277_1181127288 3 Left 1181127277 22:20709573-20709595 CCCAGCATCACCTGAGTGGCCCC 0: 2
1: 1
2: 2
3: 11
4: 159
Right 1181127288 22:20709599-20709621 GCATTAGGGGACTAAGCATTGGG 0: 2
1: 1
2: 1
3: 13
4: 384
1181127277_1181127289 4 Left 1181127277 22:20709573-20709595 CCCAGCATCACCTGAGTGGCCCC 0: 2
1: 1
2: 2
3: 11
4: 159
Right 1181127289 22:20709600-20709622 CATTAGGGGACTAAGCATTGGGG 0: 2
1: 1
2: 0
3: 6
4: 87
1181127277_1181127283 -10 Left 1181127277 22:20709573-20709595 CCCAGCATCACCTGAGTGGCCCC 0: 2
1: 1
2: 2
3: 11
4: 159
Right 1181127283 22:20709586-20709608 GAGTGGCCCCATGGCATTAGGGG 0: 2
1: 0
2: 2
3: 9
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181127277 Original CRISPR GGGGCCACTCAGGTGATGCT GGG (reversed) Intronic
900521859 1:3109777-3109799 TGGGCCACTCAGGTGATATTTGG - Intronic
900534555 1:3170533-3170555 GGGGCCACCCAGATGCTCCTAGG - Intronic
900788477 1:4664550-4664572 GGGGCCCCCCAGCTGATGGTGGG - Intronic
901067586 1:6501799-6501821 GGGGACACTCATGTCATGATGGG - Intronic
901493472 1:9608397-9608419 GGGGCCACTCTAGTTATTCTAGG + Intronic
902922536 1:19675362-19675384 AGGGCCACTCAGGTTTTGGTTGG + Intronic
904484295 1:30814661-30814683 GGGGAGACTCAGATGGTGCTGGG - Intergenic
905023915 1:34837015-34837037 GTGGTCACTCAGCTGCTGCTAGG - Intronic
908319257 1:62964639-62964661 GGGGCCAGGCTGGTGGTGCTTGG - Intergenic
908595871 1:65688220-65688242 GAGGCCCCTCAGGAGATGCTTGG + Intergenic
910496550 1:87835281-87835303 GGGACCACTGTGGTGAGGCTAGG + Intergenic
919897898 1:202020825-202020847 GGGGCCACACAGGTACTGCATGG - Intergenic
920370771 1:205477912-205477934 AGGCCCAGTCAGGGGATGCTTGG - Intergenic
922571267 1:226635871-226635893 GGCCCCACTGAGGTGATGCAGGG - Intronic
922731337 1:227950080-227950102 GGGACCACTAAGCTGCTGCTGGG - Intergenic
922764558 1:228150334-228150356 GGGGCCCCTCAGGTAGTGATAGG + Intronic
923520145 1:234728945-234728967 GGGGCCACTGATGTGGTGCCAGG + Intergenic
924179423 1:241425132-241425154 GGGGCCTGTCAGGGGATGGTGGG - Intergenic
1068429199 10:56910470-56910492 GAGGCCACTGAGTTGATACTGGG - Intergenic
1069766941 10:70869335-70869357 GGGGCCACTGAGCTGATGCTTGG + Intronic
1069919526 10:71808014-71808036 GAGGCCACTCATGTGCTGCCAGG - Intronic
1070659425 10:78293954-78293976 GGGACCACACAGGTGACACTTGG + Intergenic
1071144310 10:82549790-82549812 GTGGTCAATAAGGTGATGCTTGG + Intronic
1072178647 10:92956587-92956609 GGGGCCAAGCAGGTAATTCTAGG - Intronic
1074018664 10:109562004-109562026 GGGTCCACTTGGATGATGCTTGG - Intergenic
1075040557 10:119104161-119104183 GCGGACACTCAGCTGATGCTTGG + Exonic
1075780140 10:125012190-125012212 GGGACCACCCATGTGAGGCTGGG - Intronic
1075829923 10:125399903-125399925 GGGGACACTCAGGTCATCTTGGG + Intergenic
1075943511 10:126411287-126411309 GGGCCCTAACAGGTGATGCTTGG + Intergenic
1076711845 10:132340397-132340419 TGGCCCACTCACGTGCTGCTGGG - Intronic
1077303017 11:1855798-1855820 GGGGACTCTCTGGTGACGCTGGG + Intronic
1078142109 11:8700156-8700178 GGGGCCACTAAGGTCAGGCCAGG + Intronic
1080024499 11:27599505-27599527 TGGGCTACTCAGGTGAGGGTAGG - Intergenic
1082035520 11:47642434-47642456 GCGGCCAGTCAGGTGCTCCTGGG - Exonic
1083830484 11:65229265-65229287 GGGCCCACTCAGATGATCCAGGG - Intergenic
1084536313 11:69759318-69759340 GGGTCACCACAGGTGATGCTTGG - Intergenic
1084682154 11:70672748-70672770 GGGGGCACTCATGTGCTACTGGG - Intronic
1085726733 11:78961265-78961287 GGGGCTATTAAGGTGATCCTAGG + Intronic
1090724699 11:129514244-129514266 GGGGCCTGTCAGGGGATGGTGGG - Intergenic
1098084387 12:66826291-66826313 GGGGCCTGTCAGGGGATGCGGGG + Intergenic
1098434558 12:70454620-70454642 GGGGCCTCTCAGGGGGTGCCAGG - Intergenic
1101415099 12:104501955-104501977 GAGTCCACTCATGTGCTGCTAGG - Intronic
1101911565 12:108863914-108863936 GGGGCCAGTCAGGGGGTGGTGGG - Intronic
1102180941 12:110911688-110911710 GGGGCCAGGCAGGTTATGCAAGG + Intronic
1102513898 12:113434045-113434067 GGGGCCACCAAGGAGATCCTGGG + Intronic
1103736139 12:123062012-123062034 GGGGCCCCTCAGTTGCTGCAGGG - Intronic
1104477784 12:129084604-129084626 GGGGCTGCTCAGGTGCTGGTAGG + Exonic
1104487333 12:129162940-129162962 GTGGCCACTTGGCTGATGCTGGG - Intronic
1107036993 13:35912178-35912200 GGGGGCTCTCAGGCAATGCTTGG + Intronic
1110465488 13:75795807-75795829 GGGGCCTGTCAGGTGATGGAGGG + Intronic
1117647847 14:57871047-57871069 GGAGGCACTCAGGTCCTGCTTGG + Intronic
1118723131 14:68608403-68608425 GGGAGCACGCAGGAGATGCTCGG + Intronic
1121052893 14:90831006-90831028 GGGGAAACTCTGGTGGTGCTGGG + Intergenic
1122720290 14:103718056-103718078 GGGGCCGCTAAGGTGATTGTCGG + Intronic
1122855138 14:104556480-104556502 GGGGCCACTCAGGAGCAGGTGGG + Intronic
1122930632 14:104931661-104931683 GGGGCCTCTTAGGTGGTGCATGG + Intronic
1123706806 15:22956621-22956643 GGGGCATCTCAGGGGAGGCTCGG + Intronic
1123827872 15:24101526-24101548 GCGCCCACACAGGTGAGGCTGGG + Intergenic
1123842331 15:24260937-24260959 GCGCCCACACAGGTGATGGTGGG + Intergenic
1123857360 15:24426996-24427018 GCGCCCACACAGGTGAGGCTGGG + Intergenic
1123861991 15:24477528-24477550 GCGCCCACACAGGTGATGGTGGG + Intergenic
1124426937 15:29570596-29570618 GGGGCCACGCAGATGGCGCTCGG - Exonic
1133416511 16:5611381-5611403 GCAGGCACTGAGGTGATGCTGGG - Intergenic
1135814584 16:25620783-25620805 GAGTCCACTAAGGAGATGCTAGG + Intergenic
1145009269 17:19358254-19358276 GGGGATACTCAGGTGAGGGTGGG - Intronic
1145009275 17:19358274-19358296 GGGGATACTCAGGTGAGGATGGG - Intronic
1145325370 17:21818260-21818282 GGAGCCACCCGGGAGATGCTGGG - Intergenic
1145774484 17:27518527-27518549 GGGGGCACTCAGATGATGAATGG - Intronic
1146581242 17:34040230-34040252 GGGGCCACTCGGGTGCGGCGCGG + Intronic
1146850561 17:36218284-36218306 GGGAGCACTCAGATGAAGCTGGG + Intronic
1147212167 17:38877994-38878016 AGGGGCACTCAGGAGCTGCTGGG - Intronic
1149487184 17:57051701-57051723 GGGGACACACAGGGGCTGCTGGG + Intergenic
1150108516 17:62478907-62478929 GGGGCCACTCGGGTGCGGCGCGG - Intronic
1150308832 17:64110621-64110643 GGGGCCCATCAGTTTATGCTTGG - Intronic
1150968857 17:70003702-70003724 GAGGCCACCCAGTTGATACTGGG - Intergenic
1152531482 17:80921907-80921929 GGGCGCACGCAGGTGGTGCTGGG - Intronic
1155690854 18:28620707-28620729 GGGGACACTTGGGTAATGCTAGG + Intergenic
1155694046 18:28662401-28662423 GGGGCCTGTCAGGGGATGGTGGG + Intergenic
1158418205 18:57268580-57268602 GGGGCCTGTCAGGTGATGGGGGG - Intergenic
1159178872 18:64874884-64874906 GGGGTCACACAGATGCTGCTGGG - Intergenic
1162894366 19:13756286-13756308 TGGGGTCCTCAGGTGATGCTGGG - Intronic
1163408104 19:17136170-17136192 GGGACCACATAGGTGAGGCTGGG + Intronic
1164598611 19:29546605-29546627 GGGGCCCCTCAGGTGAGGAATGG + Intronic
1168242044 19:55093246-55093268 GGGGACAGTCAGGGGACGCTGGG + Intronic
1168689509 19:58368343-58368365 GGGGCCACGCCGGTGGCGCTCGG + Exonic
925091122 2:1156728-1156750 GGAGACAGTAAGGTGATGCTCGG + Intronic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
927090922 2:19711940-19711962 GGGGCCCCTGATGTGATCCTGGG + Intergenic
927672610 2:25081831-25081853 TGGGCCTGGCAGGTGATGCTGGG + Intronic
927782989 2:25954399-25954421 GGTGCCACTCAGAGGCTGCTTGG + Intronic
928443863 2:31315733-31315755 GGGGACACTCAGCTGATTCCTGG - Intergenic
932263470 2:70346141-70346163 AGGGTCCCTCAGGTGTTGCTGGG + Intergenic
936109978 2:109657113-109657135 TTGGGCACTCAGGTGATACTAGG - Intergenic
936153042 2:110032057-110032079 GGGGCCACCAAGGTCATGCTGGG + Intergenic
936191638 2:110339355-110339377 GGGGCCACCAAGGTCATGCTGGG - Intergenic
938782831 2:134600926-134600948 GGGGCCACCCAGGATATGGTGGG - Intronic
945507618 2:210660560-210660582 GTGGCCACCAAGGTGATGATTGG + Exonic
948816560 2:240513290-240513312 GAGGCCACTCAGGAGCTGCACGG - Intronic
1169204349 20:3731948-3731970 GGGGCCCTTCTGGGGATGCTGGG - Intergenic
1173524134 20:43719239-43719261 GTTGCCACTCAGGAGGTGCTGGG + Intergenic
1175820734 20:61907490-61907512 GGGGCGACTCAGGCCATGGTTGG - Intronic
1176382376 21:6119827-6119849 CCGGCCACTCAGGGGCTGCTGGG + Exonic
1179741096 21:43418412-43418434 CCGGCCACTCAGGGGCTGCTGGG - Exonic
1180045851 21:45304764-45304786 GGGGCCAGGGAGGAGATGCTAGG + Intergenic
1180783707 22:18535522-18535544 GGGGCCACTCAGGTGATGCTGGG - Intergenic
1181127277 22:20709573-20709595 GGGGCCACTCAGGTGATGCTGGG - Intronic
1181240610 22:21474874-21474896 GGGACCACTCAGGTGATGCTGGG - Intergenic
1181391783 22:22588285-22588307 GGGACCTCTGAGCTGATGCTTGG + Intergenic
1181661269 22:24350932-24350954 GAGGGCACTGAGGTGATCCTGGG + Intronic
1182462285 22:30491427-30491449 GGGGCCACTCATCTGATCCATGG + Intronic
1183280530 22:36929699-36929721 CGGGCCACGTAGGTGCTGCTGGG - Exonic
1184617400 22:45647338-45647360 TGGGCCACTCAGGAGATCCAAGG - Intergenic
1184710534 22:46246974-46246996 GGGGCCCCTCAGCTGATGAAGGG - Intronic
1185020851 22:48374039-48374061 GGGGCCCAGCAGGGGATGCTGGG - Intergenic
1185101177 22:48841724-48841746 GAGGCCACTCAGGGGGTCCTGGG - Intronic
1185420024 22:50729945-50729967 GGGTCCTGTCAGGTGAGGCTGGG + Intergenic
949926749 3:9047868-9047890 GGGGCCACGCAGCCGAAGCTAGG + Intronic
950994332 3:17479782-17479804 GGGGCCACTGTGAAGATGCTGGG + Intronic
963233556 3:142933931-142933953 GTGGCCAGTCATGTGATGGTTGG - Intergenic
966247289 3:177823769-177823791 GGGGCCAATCACCTGAGGCTGGG - Intergenic
966887198 3:184383282-184383304 GGGGCAAGACAGGTGAGGCTAGG - Intronic
968093144 3:195910114-195910136 GGGGTCACTCCAGTGAGGCTGGG + Intronic
969646095 4:8430071-8430093 GGGGATACTCAGGTCATGTTTGG + Intronic
982933798 4:161443837-161443859 GGGGCTACTCAGGTTCTTCTTGG + Intronic
985484222 5:139900-139922 GGGGCCTCTGAGGGGCTGCTGGG - Intergenic
990835716 5:60017448-60017470 GGGCCCATTCAGGGGGTGCTAGG - Intronic
992417358 5:76564810-76564832 GGTGGCACAGAGGTGATGCTGGG + Intronic
993042012 5:82825001-82825023 GGGGAGACTCTGGTGATGGTAGG - Intergenic
997239482 5:132295865-132295887 GAGGCCACTCAGGTTTTTCTTGG - Intronic
997733118 5:136194814-136194836 TGGGCCACTCAGGAGATGGGGGG + Intergenic
998686768 5:144535815-144535837 GGGGCCTGTCAGGGGATGCAGGG + Intergenic
999331537 5:150676813-150676835 TGGGCCACTCTGTTGAAGCTGGG - Exonic
999798841 5:155013968-155013990 GGGGAGACTCAGGTGGTGGTTGG + Exonic
1004263629 6:14130173-14130195 AGGGAAACTCAGGTGCTGCTAGG + Intronic
1006522607 6:34580495-34580517 GGGCACACTCAGGAGCTGCTGGG + Intergenic
1009194653 6:60669332-60669354 GGGTCCACTCAGCTAATCCTGGG + Intergenic
1013511667 6:110850329-110850351 GGGGGGACTCAGGCGAAGCTGGG + Intronic
1016999415 6:149985617-149985639 GGAGGAACTCATGTGATGCTGGG + Intergenic
1017356582 6:153516986-153517008 GGGGCCTCTCAGGAGGTGGTGGG - Intergenic
1019617765 7:1973961-1973983 GGGGCCACGCTGATGCTGCTGGG + Intronic
1022889933 7:34686486-34686508 AGGGCCCCTCAGTTGATGCCTGG - Intronic
1023621508 7:42077932-42077954 GGGTCCACACTGGTCATGCTGGG + Intronic
1024613980 7:51092071-51092093 GTGGCCACTCATGTGATGTGAGG - Intronic
1026795964 7:73366251-73366273 GGCGCCACTGCAGTGATGCTGGG - Intergenic
1027178382 7:75919722-75919744 GTGGCAACTCAGTTGATGCTTGG + Intronic
1027747918 7:82101352-82101374 GGGAGCACACAGGTGATGATGGG + Intronic
1032037552 7:128531448-128531470 GGGGCCACTCGGGTGCGGCGCGG - Intergenic
1032685157 7:134225260-134225282 GGGGCCACCCTGGTGATGATTGG + Intronic
1033586821 7:142780395-142780417 GGTGCCCCTCAGGAGATGCAGGG - Intergenic
1034472251 7:151261498-151261520 GGGGTCCCTCACGTGATGCATGG + Intronic
1035698521 8:1620363-1620385 GAGGCCTCTCAGGTGAGGCGGGG - Intronic
1036686513 8:10914988-10915010 GGCGCCACTGAGGTGAGGGTGGG - Intronic
1038494539 8:27992246-27992268 AGGGGCACTCAGGTGAGTCTTGG - Exonic
1039839619 8:41284519-41284541 GCTGCCACTCAGGAGATGCTGGG + Intronic
1040323283 8:46329056-46329078 GGGGCGCCTCAGGTGCTTCTGGG + Intergenic
1040512250 8:48105691-48105713 GAGGACACTGAGGTGATGATGGG + Intergenic
1044319999 8:90791404-90791426 GCATCCACTCAGGTGAGGCTGGG + Intronic
1048726881 8:137396281-137396303 GGGGCCTGTCAGGGGATGGTTGG - Intergenic
1049285961 8:141775344-141775366 GGGGCCAGTCAGATGATGACTGG + Intergenic
1049525869 8:143126709-143126731 GGGGCCACTCAGGTGCTACTGGG + Intergenic
1057083816 9:92190680-92190702 GGGGCCTCTCAGGTGACCTTAGG - Intergenic
1057686459 9:97238750-97238772 GGTCCCAATCAGGTGCTGCTGGG - Intergenic
1060189118 9:121581143-121581165 GAGGCAGCTCAGGTGAGGCTGGG + Intronic
1060204445 9:121674348-121674370 GGGGCCACACAGGAGATACCTGG + Intronic
1060340543 9:122771802-122771824 GGGGCCTCTCAGGGGCTGCAGGG + Intergenic
1060829360 9:126704097-126704119 GGTGCCACTCACATGATGCTAGG - Intergenic
1061397191 9:130349560-130349582 GGGGCCGCTCAGGAGGTGCTAGG + Intronic
1061448379 9:130655004-130655026 AGGGCGAGTCAGGTGGTGCTTGG - Intergenic
1062405314 9:136393413-136393435 GTGGCCAACCAGGTGCTGCTGGG + Intronic
1062449455 9:136609423-136609445 GGGGCCAGTCAGTGGGTGCTGGG - Intergenic
1186669752 X:11757468-11757490 GGGGGCATTCCGGGGATGCTGGG + Intergenic
1188623766 X:32258652-32258674 GGGGCCTCTCAGGGGATGGGGGG + Intronic
1197815650 X:130495177-130495199 GCGGACACTCAGCTGATGCTTGG + Intergenic
1201405120 Y:13642324-13642346 GGCCCAACTCAGCTGATGCTTGG + Intergenic
1201483223 Y:14463345-14463367 GGGGCCTGTCAGGGGGTGCTGGG + Intergenic