ID: 1181128105

View in Genome Browser
Species Human (GRCh38)
Location 22:20713485-20713507
Sequence AGTGATCCCCAAGATTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 3, 1: 0, 2: 1, 3: 10, 4: 142}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181128105_1181128111 6 Left 1181128105 22:20713485-20713507 CCCCAGCAATCTTGGGGATCACT 0: 3
1: 0
2: 1
3: 10
4: 142
Right 1181128111 22:20713514-20713536 AAACCCCAAGGAGGCCAAGGAGG 0: 3
1: 0
2: 10
3: 43
4: 457
1181128105_1181128115 17 Left 1181128105 22:20713485-20713507 CCCCAGCAATCTTGGGGATCACT 0: 3
1: 0
2: 1
3: 10
4: 142
Right 1181128115 22:20713525-20713547 AGGCCAAGGAGGAGCCCAGCAGG 0: 3
1: 0
2: 7
3: 49
4: 456
1181128105_1181128116 18 Left 1181128105 22:20713485-20713507 CCCCAGCAATCTTGGGGATCACT 0: 3
1: 0
2: 1
3: 10
4: 142
Right 1181128116 22:20713526-20713548 GGCCAAGGAGGAGCCCAGCAGGG 0: 3
1: 0
2: 4
3: 66
4: 490
1181128105_1181128118 25 Left 1181128105 22:20713485-20713507 CCCCAGCAATCTTGGGGATCACT 0: 3
1: 0
2: 1
3: 10
4: 142
Right 1181128118 22:20713533-20713555 GAGGAGCCCAGCAGGGCCCAAGG 0: 3
1: 0
2: 3
3: 73
4: 545
1181128105_1181128109 -3 Left 1181128105 22:20713485-20713507 CCCCAGCAATCTTGGGGATCACT 0: 3
1: 0
2: 1
3: 10
4: 142
Right 1181128109 22:20713505-20713527 ACTTCTTCAAAACCCCAAGGAGG 0: 3
1: 0
2: 1
3: 10
4: 147
1181128105_1181128108 -6 Left 1181128105 22:20713485-20713507 CCCCAGCAATCTTGGGGATCACT 0: 3
1: 0
2: 1
3: 10
4: 142
Right 1181128108 22:20713502-20713524 ATCACTTCTTCAAAACCCCAAGG 0: 3
1: 0
2: 0
3: 17
4: 181
1181128105_1181128110 3 Left 1181128105 22:20713485-20713507 CCCCAGCAATCTTGGGGATCACT 0: 3
1: 0
2: 1
3: 10
4: 142
Right 1181128110 22:20713511-20713533 TCAAAACCCCAAGGAGGCCAAGG 0: 3
1: 0
2: 0
3: 18
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181128105 Original CRISPR AGTGATCCCCAAGATTGCTG GGG (reversed) Intronic
900419042 1:2547647-2547669 GGGGCTCCCCCAGATTGCTGTGG - Intergenic
900807094 1:4774620-4774642 AGTGATCCCAAAGAGTGCAGGGG - Intronic
900950826 1:5857438-5857460 AGTGCTACCCGAGGTTGCTGGGG + Intergenic
901590640 1:10338808-10338830 AGGGAACCCCAGGAATGCTGCGG + Intronic
903025698 1:20428654-20428676 AGTGAACCCCAGAAATGCTGAGG + Intergenic
903569600 1:24294637-24294659 ACTCATCCCCCAGTTTGCTGGGG + Intergenic
908114674 1:60929122-60929144 ATTCTTCCCCAAGATTTCTGTGG + Intronic
908312482 1:62899032-62899054 ATTGACCCCCAGGATTACTGTGG + Intergenic
909221515 1:72968354-72968376 AGTGATTTTCATGATTGCTGAGG - Intergenic
912954061 1:114140227-114140249 GGTGCTCCCCAAGCTGGCTGGGG - Intronic
920524356 1:206655793-206655815 AGTTGTCCCCTAGATTGTTGTGG + Intronic
1065738408 10:28774596-28774618 AGAGATCCCCAAGATTGTTAGGG - Intergenic
1067260850 10:44690052-44690074 AGTGGTCCCCCATATTGCTTTGG - Intergenic
1070757412 10:79001892-79001914 AGAGTTCCCTAAGATGGCTGTGG + Intergenic
1071191565 10:83107827-83107849 AATGATCCCCTAAATTGGTGAGG + Intergenic
1071255458 10:83868153-83868175 AGTGATCCCCCAGAATGCTGAGG - Intergenic
1071434601 10:85635452-85635474 AGTGAGCAGCAAAATTGCTGGGG - Intronic
1071475389 10:86020971-86020993 AGTGGTCTCCAAGAGTTCTGGGG - Intronic
1071588453 10:86847830-86847852 AGAGGTCCCCAAGATGGCAGTGG - Intronic
1072844791 10:98817826-98817848 AGAGTTCACCAAGATTACTGAGG + Intronic
1072995704 10:100241912-100241934 GATGTTCCCCAAGATTCCTGAGG - Intronic
1074032549 10:109703261-109703283 AGGGATCCCTGAGATTGCCGTGG - Intergenic
1075277677 10:121109393-121109415 AGTGATTCCCAAGGTGGGTGGGG - Intergenic
1075731517 10:124639321-124639343 GGAGATCCCCAAGAGGGCTGAGG + Intronic
1076827562 10:132976976-132976998 GGTCATCCCCAAGACTGCAGGGG - Intergenic
1079297052 11:19242595-19242617 ACTGATCCCCAAGTTAGCGGTGG - Intergenic
1081148153 11:39590301-39590323 AGTGATACTCAAGTTTGCTTTGG - Intergenic
1088851154 11:113704559-113704581 TGTGATCCCAAATTTTGCTGTGG - Intronic
1089209373 11:116790130-116790152 AGGGGTCCCCCAGATGGCTGTGG + Exonic
1089494644 11:118902029-118902051 ACTGATCCCCAGGCTTGCTGTGG + Exonic
1091006183 11:131955879-131955901 TGTGATGTCCAAGATTCCTGGGG + Intronic
1091080876 11:132666468-132666490 TGTGAGCCCCAAGATTGGAGTGG - Intronic
1091286271 11:134410304-134410326 AGTGATCCCCAAGCATCCTGGGG + Intronic
1091513303 12:1152314-1152336 AATGATCCCCAGGGTTTCTGTGG + Intronic
1094139016 12:27161334-27161356 AGTGAACTCAATGATTGCTGAGG - Intergenic
1096271150 12:50167259-50167281 AGGGACCCCTAAGCTTGCTGTGG - Exonic
1098520808 12:71433281-71433303 AGTGATCCCCAGCCTTTCTGGGG - Intronic
1099364738 12:81754188-81754210 AGTGATGCCCACGATTAATGAGG - Exonic
1099583605 12:84485985-84486007 ACACATCCCCAAAATTGCTGTGG - Intergenic
1101874324 12:108588793-108588815 TGTGACCCCCAAGACTGGTGGGG - Intergenic
1101879008 12:108613875-108613897 GGTGGTGCCAAAGATTGCTGAGG - Intergenic
1102482298 12:113232278-113232300 AGGGATCCTCCACATTGCTGAGG - Intronic
1103929494 12:124441916-124441938 AGTGATCTTCAAAAGTGCTGGGG + Intronic
1104345319 12:127991378-127991400 TGTGATCCCCAGGCATGCTGAGG - Intergenic
1108059844 13:46521696-46521718 AGTGAACCCCAAAATTTCAGCGG + Intergenic
1108470687 13:50763862-50763884 AGTATTTCCCAGGATTGCTGTGG + Intronic
1108866528 13:54930595-54930617 AGAGATGCCAAGGATTGCTGGGG + Intergenic
1114841349 14:26266216-26266238 AGAGATTCCCAAGATTGCATAGG - Intergenic
1115330344 14:32190291-32190313 AGTGATTGCCAAGGTTGGTGGGG - Intergenic
1118704983 14:68472085-68472107 AGTGATGCTCAAGTGTGCTGGGG + Intronic
1121319389 14:92982195-92982217 AGTCAACCCCAAGATCCCTGTGG + Intronic
1202883797 14_KI270722v1_random:85136-85158 AATGACCCCCAGGAGTGCTGAGG - Intergenic
1125597662 15:40897776-40897798 AGAGATATCCCAGATTGCTGAGG - Intronic
1126318991 15:47401620-47401642 ACTGTTTCCCAAGAATGCTGAGG + Intronic
1127292493 15:57582865-57582887 AGTGAGACCCAAGTTTGATGAGG - Intergenic
1127866137 15:63034734-63034756 AGTGATGCCAAGGAATGCTGTGG + Intergenic
1132458510 16:37564-37586 CCTGAGCCCCAAGATTCCTGGGG + Intergenic
1133835464 16:9363563-9363585 AGAGGTCCCCAAGATTCATGGGG - Intergenic
1137805040 16:51296998-51297020 TATGAACCCAAAGATTGCTGAGG - Intergenic
1139590707 16:67931358-67931380 AGGGATAACCAAGATAGCTGTGG - Intronic
1139735709 16:68986335-68986357 AGTGACCCCCAGGAATCCTGAGG + Intronic
1145978228 17:28996530-28996552 AGTGAAGCCCAAGATTGGGGAGG + Intronic
1148494886 17:48047869-48047891 AGTGAGACCCGAGAATGCTGAGG - Intergenic
1149981597 17:61315584-61315606 AGTGAACCCCAATGATGCTGGGG + Intronic
1153139466 18:1954876-1954898 AGAGATCTCCAAGAATGCAGGGG + Intergenic
1162701822 19:12521583-12521605 AGTCATACTCAAGATTGCTTTGG - Intronic
1163741270 19:19014550-19014572 AGCGATCCCCCAGATCACTGGGG - Intronic
1166026854 19:40094935-40094957 AGTGAACACCAACTTTGCTGTGG + Intergenic
1167517091 19:49929759-49929781 ATTGATCCCCAAGAGGGCGGAGG + Intronic
1202632943 1_KI270706v1_random:16615-16637 AATGACCCCCAGGAGTGCTGAGG - Intergenic
1202652931 1_KI270707v1_random:23435-23457 AATGACCCCCAGGAGTGCTGAGG + Intergenic
926587202 2:14700100-14700122 AGTAATTCACAAGATTGCTTTGG + Intergenic
928231968 2:29506060-29506082 AGTGATCCCCTAGGTAACTGTGG + Intronic
935625371 2:105168258-105168280 AGTGGTCCTCATGAGTGCTGAGG - Intergenic
942164850 2:173231869-173231891 AGTGGTCCCCTGGATTGCTGAGG - Intronic
946301042 2:218824227-218824249 AGTGATCGACAGGATTGCTCGGG - Exonic
948192640 2:236071758-236071780 AGTGCTCCCCAGTGTTGCTGGGG + Intronic
1168775241 20:441796-441818 AGTTATCCCCAGGACGGCTGAGG + Intronic
1169649618 20:7852526-7852548 CGTGATCCACAGTATTGCTGAGG + Intergenic
1172203915 20:33148459-33148481 AGTGATCACCAGGCTTACTGGGG + Intergenic
1176599220 21:8776216-8776238 AATGACCCCCAGGAGTGCTGAGG - Intergenic
1176645166 21:9342495-9342517 AATGACCCCCAGGAGTGCTGAGG - Intergenic
1177010106 21:15721827-15721849 AGAGAAATCCAAGATTGCTGTGG - Intergenic
1180326684 22:11435835-11435857 AATGACCCCCAGGAGTGCTGAGG - Intergenic
1180367788 22:11956739-11956761 AATGACCCCCAGGAGTGCTGAGG + Intergenic
1180378306 22:12114595-12114617 AATGACCCCCAGGAGTGCTGAGG - Intergenic
1180419208 22:12798684-12798706 AATGACCCCCAGGAGTGCTGAGG + Intergenic
1180784528 22:18539432-18539454 AGTGATCCCCAAGATTGCTGGGG - Intergenic
1181128105 22:20713485-20713507 AGTGATCCCCAAGATTGCTGGGG - Intronic
1181241431 22:21478789-21478811 AGTGATCCCCAAGATTGCTGGGG - Intergenic
1181369433 22:22404634-22404656 AGTGATGCCCAGGGTGGCTGAGG - Intergenic
1183248485 22:36711642-36711664 AGGTGTCCCCAGGATTGCTGGGG + Intergenic
957095155 3:75771549-75771571 AATGACCCCCAGGAGTGCTGAGG + Intronic
957788413 3:84909918-84909940 ACTGCTGCCCTAGATTGCTGGGG + Intergenic
960873737 3:122276171-122276193 AGGGAGCCCCAAGATTGCAAAGG - Intronic
961864442 3:129943402-129943424 AGTGATCCCCAGGATGTCTGTGG - Intergenic
963464033 3:145654834-145654856 TGTGATCCCCAGGGTTGATGTGG + Intergenic
964949972 3:162278252-162278274 AGTGATACCTAAGATTGCAGAGG - Intergenic
966216027 3:177503492-177503514 ATTGATCACCAAGGTTGATGTGG - Intergenic
1202741726 3_GL000221v1_random:62573-62595 AATGACCCCCAGGAGTGCTGAGG + Intergenic
968393958 4:215961-215983 TGTAATCCCCAAGAATGCAGAGG + Intergenic
968410990 4:389795-389817 TGTAATCCCCAAGAATGCAGAGG + Intergenic
969069941 4:4528268-4528290 TGTGATCCCCAATATTGGAGGGG + Intronic
970778778 4:19710000-19710022 AGGTATCTCCAAGATTGCTGAGG + Intergenic
972764573 4:42140678-42140700 ACTGAACCCCAAGTTTGCTTAGG + Intronic
973362582 4:49178589-49178611 AATGACCCCCAGGAGTGCTGAGG - Intergenic
973398520 4:49618264-49618286 AATGACCCCCAGGAGTGCTGAGG + Intergenic
1202759927 4_GL000008v2_random:100061-100083 AATGACCCCCAGGAGTGCTGAGG - Intergenic
988702561 5:33689881-33689903 AATGAACCCCAAAGTTGCTGGGG + Intronic
988917746 5:35912163-35912185 AGGGATGCCCACCATTGCTGAGG + Intronic
992207770 5:74447630-74447652 AGTGCTCCTCAAGCTTTCTGAGG + Intergenic
999084987 5:148880024-148880046 AGTGATTCCCAACATTTTTGAGG - Intergenic
999339160 5:150753938-150753960 ATTGATCACAAAGATTTCTGAGG + Intronic
1000050772 5:157561312-157561334 AGAGATCGCCAAGAATGGTGAGG - Intronic
1003443309 6:6163158-6163180 ACTGAGCCTCAAGGTTGCTGTGG - Intronic
1003454946 6:6273390-6273412 ATTGAACACCCAGATTGCTGTGG - Intronic
1003652731 6:7976210-7976232 AGTGTTCCCTAAGCTTGCTCTGG + Intronic
1005619311 6:27605388-27605410 AATGATCTCCAACAGTGCTGCGG + Intergenic
1007509592 6:42364901-42364923 AGGGATCCCCATGCTTCCTGCGG - Intronic
1008659109 6:53647191-53647213 AGACATCCCCAAGATTGTTGTGG + Intergenic
1010033163 6:71290060-71290082 ATTGATCATCAAGATGGCTGAGG - Intronic
1010310444 6:74378622-74378644 AGGGGTGCCCAACATTGCTGAGG - Intergenic
1011290549 6:85772548-85772570 AGTGATGTGCAAGATTGCTCTGG + Intergenic
1013089878 6:106890735-106890757 TGTGACCTCCAAGATTGTTGAGG - Intergenic
1015453090 6:133393079-133393101 AGTATTCTCCAAGATTGCTTAGG + Intronic
1017658537 6:156652315-156652337 AGAGATACCAAAGATTTCTGTGG - Intergenic
1017766595 6:157612035-157612057 AGTGACCCCCCACCTTGCTGAGG + Intronic
1022816939 7:33923016-33923038 AGTGAGTCCCAAGATGGTTGTGG + Intronic
1025228853 7:57185607-57185629 AGAGAACCAGAAGATTGCTGTGG - Intergenic
1027683132 7:81245511-81245533 AGTGAACCCCAGGGCTGCTGTGG + Intergenic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1030777637 7:113553848-113553870 TGTGATCCCCAATGTTGCAGGGG - Intergenic
1031424042 7:121584438-121584460 AGTGAACCCTAGGAGTGCTGGGG - Intergenic
1034866562 7:154647305-154647327 AGTGACACCCAGGATTGCCGTGG + Intronic
1036609542 8:10337728-10337750 AGTGAGCCCCAGCATGGCTGAGG - Intronic
1044191051 8:89317930-89317952 AATGTTTCCCAAGATTGGTGAGG - Intergenic
1046700403 8:117394604-117394626 ATTGAGCCCAAAGATTACTGAGG + Intergenic
1046822284 8:118647330-118647352 AATGATTCCCAAAATTGCAGAGG - Intergenic
1048493996 8:134920343-134920365 CGTGAGCCCCAAGAAAGCTGTGG - Intergenic
1048951672 8:139501665-139501687 AGAGAGCCCCAAGAGTGATGTGG - Intergenic
1049738374 8:144222088-144222110 TGTGATCCCCATGTTTCCTGGGG - Intronic
1050075179 9:1855666-1855688 AGTGATTTCTAAAATTGCTGAGG + Intergenic
1050746568 9:8883175-8883197 AGTGCTCTGCAAGATTGTTGTGG - Intronic
1052038123 9:23706297-23706319 AGTGATGACCAAGAATGATGTGG - Intronic
1053160755 9:35811757-35811779 AGGGCTCCCCAAGAAGGCTGGGG + Exonic
1062528716 9:136990147-136990169 ATTCATCCCCAAGATGACTGGGG - Intergenic
1203540700 Un_KI270743v1:84955-84977 AATGACCCCCAGGAGTGCTGAGG - Intergenic
1189097073 X:38151687-38151709 ATTCATCCCCAAGATTTCTGTGG - Intronic
1190274872 X:48893187-48893209 AATGAACACCAGGATTGCTGGGG - Intergenic
1192238728 X:69313346-69313368 AGTGATCCCCCTGACTGCTAAGG - Intergenic
1192802529 X:74480171-74480193 AGGGACGCCCAACATTGCTGAGG - Intronic
1195931547 X:110082187-110082209 AACGATGCCCAAGGTTGCTGTGG - Intronic
1202166582 Y:21995815-21995837 AGGGACACCCATGATTGCTGAGG - Intergenic
1202224776 Y:22590558-22590580 AGGGACACCCATGATTGCTGAGG + Intergenic
1202318338 Y:23605102-23605124 AGGGACACCCATGATTGCTGAGG - Intergenic
1202552429 Y:26064955-26064977 AGGGACACCCATGATTGCTGAGG + Intergenic