ID: 1181130694

View in Genome Browser
Species Human (GRCh38)
Location 22:20729976-20729998
Sequence CAGTTATGTCCAGGTTGCTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181130689_1181130694 9 Left 1181130689 22:20729944-20729966 CCAGCCTTGGGTGGCTTGTTGCC 0: 1
1: 0
2: 2
3: 10
4: 155
Right 1181130694 22:20729976-20729998 CAGTTATGTCCAGGTTGCTCCGG 0: 1
1: 0
2: 0
3: 11
4: 217
1181130690_1181130694 5 Left 1181130690 22:20729948-20729970 CCTTGGGTGGCTTGTTGCCGAGA 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1181130694 22:20729976-20729998 CAGTTATGTCCAGGTTGCTCCGG 0: 1
1: 0
2: 0
3: 11
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181130694 Original CRISPR CAGTTATGTCCAGGTTGCTC CGG Exonic
900711057 1:4114598-4114620 CAGTTATGCCCAGCCTGCTGAGG + Intergenic
903920270 1:26795050-26795072 CACGTATGTCCAAGTTGCCCAGG - Exonic
904060760 1:27708377-27708399 CAGTGAGGTCCAGGCTGCTGAGG + Intergenic
905084711 1:35362341-35362363 CTGCTATTTCAAGGTTGCTCTGG + Intronic
905983195 1:42250770-42250792 GAGTTTTGTCCTTGTTGCTCAGG - Intronic
906030699 1:42717898-42717920 CAGTCATCTCCTGGTTGCTAAGG - Intergenic
906561886 1:46764352-46764374 CAGCTCTGCCCAGGATGCTCTGG + Intronic
907346049 1:53781438-53781460 CAGTGATCTCCAGGATGGTCTGG + Intronic
907556843 1:55351311-55351333 CCTTTATGTCCAGGTGGGTCTGG - Intergenic
909364160 1:74799918-74799940 CAGTAAAGTCCAGGCTGCTGAGG - Intergenic
909900582 1:81129657-81129679 TAGTTATTTCCAGGTGCCTCAGG - Intergenic
910608208 1:89110559-89110581 CAGTTCCATCCAGGTTGCTATGG - Intronic
911103353 1:94111058-94111080 GAGATCTGTCCAGGTTGATCAGG + Intronic
918780700 1:188696534-188696556 CAGATTTGTCCATTTTGCTCAGG + Intergenic
919215330 1:194546202-194546224 CAGTTTTGTCCATTTTGCTCGGG + Intergenic
919647597 1:200110873-200110895 GAGTTAGGTCCAGGTGCCTCAGG - Intronic
924165377 1:241276163-241276185 CAGTTATTTCCAGGTTCTTTAGG - Intronic
1062881427 10:981193-981215 CAGTGAAGTCCAGGCTGCTGAGG - Intergenic
1063065607 10:2605679-2605701 CAGTTATTTCCATGCTGTTCTGG - Intergenic
1063132741 10:3192635-3192657 CAGTCATTTCCAGGTGGCTGAGG + Intergenic
1069472789 10:68707748-68707770 GAGTGAAGGCCAGGTTGCTCTGG + Intergenic
1069900282 10:71702916-71702938 AAGTCATGTCCAAGTTTCTCAGG + Intronic
1074824466 10:117204570-117204592 CAGTGATGTCGATGTTACTCAGG - Intronic
1078994847 11:16686569-16686591 CAGTGAAGTCCAGGCTGCTGAGG - Intronic
1079872821 11:25821802-25821824 CAGTGATGTCCAGATTGATGGGG + Intergenic
1081325504 11:41739151-41739173 CAGTAATGTCCAGGTTGAGGAGG - Intergenic
1081665246 11:44913039-44913061 CAGTTAGGTCCAGGTTCAGCCGG - Intronic
1084309275 11:68307154-68307176 CAGTTTTGTTCTTGTTGCTCAGG - Intergenic
1085064470 11:73481251-73481273 CAGTTATGTGCAACTTTCTCTGG + Intronic
1085230740 11:74967556-74967578 CAGATTTCTCCAAGTTGCTCAGG - Intronic
1085482636 11:76835486-76835508 CATTTAAGTCCAGGTTCGTCTGG + Intergenic
1087473196 11:98603265-98603287 CAGGTTTCTCCATGTTGCTCAGG - Intergenic
1088331123 11:108653114-108653136 CAGTTCTGTTCATTTTGCTCAGG - Intergenic
1088715493 11:112545574-112545596 CAGTCATGTTCAGGTTGTACAGG - Intergenic
1090090553 11:123693630-123693652 CAGTTATGTCAAGGATCCTGGGG - Intergenic
1092359813 12:7827134-7827156 GAGTTCTGCCCTGGTTGCTCCGG + Intronic
1094853069 12:34390916-34390938 CAGTGATGCCCAGGTTCCCCTGG - Intergenic
1095636616 12:44441535-44441557 CAGTTTTCTCAAGGTTGTTCAGG - Intergenic
1096450105 12:51732512-51732534 CAGTTTTGTTCTTGTTGCTCAGG + Intronic
1097496224 12:60339440-60339462 CAGTTATCTCCAGGCTGAACTGG + Intergenic
1098281043 12:68863209-68863231 CTTTTATGCCCAGGTTGCTTAGG + Intronic
1099041739 12:77663710-77663732 CAGTTTTCTCCATGTTGGTCAGG + Intergenic
1099616390 12:84941076-84941098 CAGTTTTGTTCATTTTGCTCAGG - Intergenic
1099992096 12:89734525-89734547 CAGTGATATCCAGATTGGTCTGG - Intergenic
1099992653 12:89741992-89742014 CAGTTTTGTTCTGTTTGCTCAGG - Intergenic
1100407310 12:94282956-94282978 TTGTTATGTGCAGGTTTCTCTGG - Intronic
1100823689 12:98455364-98455386 CTGTTTTGTCCAGTTTCCTCTGG + Intergenic
1103226746 12:119294320-119294342 CAGTTATGTTCAGACGGCTCTGG + Intergenic
1103510793 12:121472355-121472377 CAGTTTTATCCAGGTAGCCCTGG - Intronic
1105528995 13:21201270-21201292 CAGTGAAGTCCAGGCTGCTGAGG - Intergenic
1105866698 13:24467346-24467368 CAAATATGTCCAGGTTGCCATGG + Intronic
1105941835 13:25154525-25154547 CACTTGTGTCAAGGTGGCTCGGG + Intergenic
1106114394 13:26804490-26804512 CAGTTTTCTCCATGTTGGTCAGG + Intergenic
1106734028 13:32571183-32571205 CAGTTTTGCCCTTGTTGCTCAGG + Intergenic
1106785569 13:33105111-33105133 CAGTTCTTTCCAAGTGGCTCTGG - Exonic
1106828013 13:33545149-33545171 CAGTTTTCTCCATGTTGGTCAGG + Intergenic
1107551590 13:41480747-41480769 CAGTTTTGTTCATTTTGCTCAGG + Intergenic
1114773007 14:25450370-25450392 AAATTATCTCCAGGCTGCTCAGG + Intergenic
1114783375 14:25565511-25565533 CAGTTTTGTTCTGTTTGCTCAGG + Intergenic
1115673359 14:35641797-35641819 CAGTTTTGTTCATTTTGCTCAGG - Intronic
1116383238 14:44297792-44297814 CAGTGAAGTCCAGGCTGCTGAGG - Intergenic
1117504038 14:56383283-56383305 CAGTTTTGTTCTGTTTGCTCAGG + Intergenic
1120095987 14:80388137-80388159 CAGTTATGCCTAGGTTGTTTGGG - Intergenic
1122227962 14:100290721-100290743 CAGTTGTGCCCAAGTTGCCCGGG + Intergenic
1123753088 15:23373529-23373551 CAGTTTTCTCCATGTTGGTCAGG - Intergenic
1124941806 15:34225209-34225231 CAGTGATGTACAGCTTGCCCAGG - Intronic
1124945407 15:34261084-34261106 CAGATAAGTGCAGGTTGCTTCGG + Intronic
1127782345 15:62328311-62328333 CAGTTTTCTCCATGTTGCCCAGG + Intergenic
1131088792 15:89602667-89602689 CAGTTATCTTAAGGTTGTTCTGG - Intronic
1131528410 15:93171462-93171484 GATTTATGTCCAAGTTGTTCTGG + Intergenic
1133234403 16:4381180-4381202 CTGTCAGGTCCAGGTTGCTGAGG - Exonic
1134297706 16:12961567-12961589 CAGTTTTGGCCGGGGTGCTCTGG - Intronic
1135395089 16:22125184-22125206 CAGGTCTGCCCATGTTGCTCAGG - Intronic
1135666014 16:24336250-24336272 CAGTGATCTCCAGATTGCTGGGG - Intronic
1137225276 16:46499206-46499228 CAGTTAGGTCCAGATTTCCCAGG - Intergenic
1138692035 16:58777234-58777256 CAGTGATTTCCATATTGCTCAGG - Intergenic
1139910364 16:70393888-70393910 CAGTTAAGACCAGGTTTCCCAGG - Intronic
1141963057 16:87422229-87422251 CAGTTCTGCCCAGGCTGCTGTGG - Intronic
1142551696 17:744729-744751 CTGTAAAGTCCAGGCTGCTCGGG + Exonic
1143198465 17:5095570-5095592 CAGTGAAGTCCATATTGCTCAGG - Exonic
1147518244 17:41142550-41142572 CAGAGATCTCCAGGTTCCTCAGG - Intergenic
1147871111 17:43588272-43588294 CTGTTTTGTCCAGGCTGCTTGGG - Intergenic
1148165852 17:45483506-45483528 CAGGTCTGTCCAAGTTGCTGTGG - Intronic
1148368141 17:47072154-47072176 CAGGTCTGTCCAAGTTGCTGGGG + Intergenic
1148781948 17:50127409-50127431 CAGTTTTTTCCATGTTGGTCAGG - Intronic
1150397075 17:64830220-64830242 CAGGTCTGTCCAAGTTGCTGTGG - Intergenic
1155114599 18:22752040-22752062 CAGATATGTGCAGGGTGCTGGGG - Intergenic
1157132532 18:45020382-45020404 CAGTTAGGTCCAGGCTTGTCTGG - Intronic
1160095036 18:75863536-75863558 AAGTCATTTCCAGGCTGCTCGGG + Intergenic
1163590194 19:18189121-18189143 CAGTTTTGTTCTGTTTGCTCAGG - Intergenic
1168353619 19:55689563-55689585 CAGCTGTGCCAAGGTTGCTCGGG + Intronic
926867885 2:17379690-17379712 CAGTTTTGTACATTTTGCTCAGG + Intergenic
927667289 2:25041764-25041786 CAGTTCTGTCCAGGCTGCGTGGG - Intergenic
928298374 2:30105074-30105096 CAGGTATCTCCATGTTGGTCAGG + Intergenic
928638811 2:33276522-33276544 CGTTTGTGTCCAAGTTGCTCTGG + Intronic
930041217 2:47126164-47126186 CAGTTTTGTTCATTTTGCTCAGG + Intronic
931722067 2:65073932-65073954 CAGATACGTCCATGTTTCTCTGG - Intronic
931927592 2:67091026-67091048 CAGTTTTGTTCTTGTTGCTCAGG - Intergenic
936734846 2:115428121-115428143 CAGTGAAGTCCAGGCTGCTGAGG - Intronic
937462878 2:122104376-122104398 CAGTGAAGTCCAGGTTGCTGAGG - Intergenic
938616849 2:133008103-133008125 CAATTGTGTCCAGGTGACTCAGG + Intronic
940989604 2:160084463-160084485 CAGTTATGTTCAGTTTTCTCAGG + Intergenic
941718911 2:168792670-168792692 CAGTTTTCGCCATGTTGCTCAGG + Intronic
941747215 2:169099503-169099525 CTGTGTTGTCCAGGCTGCTCTGG - Intergenic
942268924 2:174254577-174254599 GAGTTTTCTCCATGTTGCTCAGG + Intergenic
943831003 2:192461950-192461972 CAATGAAGTCCATGTTGCTCAGG - Intergenic
944990213 2:205226801-205226823 TAGTTTTGTTCAGTTTGCTCAGG + Intronic
945205430 2:207326700-207326722 CAGTTATGTCTATGTTACTCAGG + Intergenic
946056080 2:216903090-216903112 CAGTGAAATCCAGGTTGCTGAGG - Intergenic
1173682575 20:44895966-44895988 CAATTATGTACAGGATGCTGTGG + Intronic
1173721981 20:45267525-45267547 GAGTTATGTCCAAATTGCTCGGG - Intergenic
1174615268 20:51830511-51830533 CAGTGTTGTCCAGGCTGGTCTGG - Intergenic
1177154918 21:17491808-17491830 AAGTTTTGTCCAGGTTGATGCGG - Intergenic
1177406268 21:20672694-20672716 CAGTGATGTCCAGGCTGCCAAGG + Intergenic
1177970474 21:27783421-27783443 CAGTTTTGTTCTGTTTGCTCAGG - Intergenic
1179713338 21:43275336-43275358 CAGTAATGTCCAGGAAGCTATGG + Intergenic
1180726868 22:17952825-17952847 CAGCTCTGTCCATGTGGCTCTGG + Intronic
1181130694 22:20729976-20729998 CAGTTATGTCCAGGTTGCTCCGG + Exonic
1181428770 22:22863818-22863840 CAGTGAAGTCCAGGCTGCTGAGG - Intronic
1183541735 22:38433254-38433276 CAGTTTTCTCCATGTTGGTCAGG - Intronic
1184442696 22:44527904-44527926 CAGTTTTCTCCATGTTGGTCAGG + Intergenic
949310214 3:2689142-2689164 CAGTTCTTGCCAGGTTGCTACGG + Intronic
950913961 3:16624452-16624474 CAGTTTTGTCCTTTTTGCTCAGG - Intronic
951820133 3:26799090-26799112 CAGTTTAGTCCAGTTAGCTCTGG + Intergenic
954707748 3:52490019-52490041 CTGGTATGTGCAGGTTGCTAGGG + Intronic
955962917 3:64359087-64359109 CACTTTTGTCCAGGCTGCTGGGG + Intronic
956681968 3:71789391-71789413 CTGTTTTGTCCAGGCTGGTCTGG - Intergenic
957808015 3:85176492-85176514 CAGTAATGTGCAGTTTGCTTTGG + Intronic
958005619 3:87807070-87807092 CAGTTTTGTCCTTTTTGCTCAGG + Intergenic
958083994 3:88782125-88782147 CAGTTTTGTCCATTTTGCTAAGG - Intergenic
962607493 3:137044826-137044848 CAGGTTTCTCCAGGTTGCCCAGG + Intergenic
963521033 3:146360203-146360225 CAGTAAAGTCCAGGCTGATCAGG + Intergenic
963803479 3:149699725-149699747 CAGTAAAGTCCAGGCTGATCAGG - Intronic
965905365 3:173699045-173699067 GCGTTATCTCCAGGTTGTTCAGG + Intronic
966979739 3:185121074-185121096 CAGTCCTATCCAGGTTGCTGTGG - Intronic
967502211 3:190211713-190211735 CAGTTATGTTCATTTTGCTTAGG - Intergenic
967699895 3:192579759-192579781 CAGTTTTCTCCATGTTGCCCAGG + Intronic
968747860 4:2370354-2370376 CAGGTGTGTCCAGGGGGCTCAGG - Intronic
971940715 4:33211838-33211860 CAGTTATGTCGATCTTGCCCAGG + Intergenic
972338345 4:38128605-38128627 CAGCTGTGTCCCAGTTGCTCAGG - Intronic
972753925 4:42024312-42024334 CATTTATGTCTATGTTGCCCAGG - Intronic
973542182 4:51945731-51945753 CAGTGAAGTCCAGGCTGCTGAGG + Intergenic
973614156 4:52662465-52662487 CAGTGAAGTCCAGGCTGCTGAGG + Intergenic
975910155 4:79258195-79258217 CAGCTATGTCCAGGATGGCCAGG - Intronic
976148754 4:82071292-82071314 CGGGTATGTAAAGGTTGCTCTGG + Intergenic
976989034 4:91340974-91340996 CAGTTATGTCCATTATGCTCAGG - Intronic
977946255 4:102917876-102917898 CAGGTTTCTCCATGTTGCTCAGG - Intronic
978172681 4:105692505-105692527 AAGTTATTTCCAGGTTGTTCTGG + Intronic
983017631 4:162633739-162633761 CAGTTTTGTTCTGTTTGCTCAGG - Intergenic
986334289 5:6741627-6741649 CAGTGGTGTCCAGGTGACTCTGG + Intronic
987611337 5:20207864-20207886 CAGTTTTGTTCATTTTGCTCTGG - Intronic
989106848 5:37870821-37870843 CAGTGATGTTCAGGCTGCACGGG + Intergenic
989130966 5:38106159-38106181 CACTTGGGTCCAGGTTGCTGAGG - Intergenic
989214604 5:38891739-38891761 CAGCTAGCACCAGGTTGCTCAGG - Intronic
989321443 5:40139170-40139192 CAGTTATCTCCAGGTTTTTTTGG - Intergenic
990642569 5:57804205-57804227 CAGTTATGGGGAGGTTGCTTAGG - Intergenic
990982874 5:61617311-61617333 CAGCTAGCTCCAGGCTGCTCTGG + Intergenic
992364803 5:76081032-76081054 CATTTAAGACCAGGTTGCACTGG - Intergenic
992987525 5:82248398-82248420 CTCTTATGGCCAGATTGCTCTGG + Intronic
993016781 5:82543729-82543751 TAGTAATGTCCAGGCTGCTGAGG + Intergenic
995196279 5:109372712-109372734 CAGTTTTCTCCATGTTGCTTAGG - Intronic
996207817 5:120763499-120763521 CAGTTTTGTCCTTTTTGCTCAGG + Intergenic
999385503 5:151151273-151151295 CAGTATGGTCTAGGTTGCTCTGG - Intronic
1003071480 6:2948552-2948574 CAGTCATGCCCAGGTTGCGCAGG + Exonic
1003402965 6:5806102-5806124 CAGTGAAGTCCAGGCTGCTGAGG + Intergenic
1005685383 6:28248635-28248657 CAGGTTTCTCCAGGTTGCCCAGG - Intronic
1005956456 6:30666780-30666802 CAGTTTTGTTCTTGTTGCTCAGG - Intronic
1009546980 6:65032936-65032958 CAGTGAAGCCCAGGTTGCTGAGG + Intronic
1010012538 6:71066124-71066146 CAGTTATCTCCAACTTCCTCGGG + Intergenic
1011024369 6:82850860-82850882 CAGTTATGTTCTTTTTGCTCTGG - Intergenic
1011504746 6:88029109-88029131 CAGTGAAGTCCAGGCTGCTGAGG - Intergenic
1014235719 6:118952158-118952180 CAGTTATGTTCATTTTTCTCTGG + Intergenic
1015303148 6:131677033-131677055 CTGTGTTGTCCAGGTTGGTCCGG - Intronic
1015666842 6:135640417-135640439 GAATGATGTCCAGGTTGCTGGGG - Intergenic
1020355555 7:7271512-7271534 CAGTCCTGTCCCGGTTCCTCGGG - Intergenic
1024979458 7:55145252-55145274 CAGGGATGTCCAGGCTGCTGTGG - Intronic
1028595334 7:92542617-92542639 CAGTTTTCTCCATGTTGGTCAGG - Intergenic
1029372445 7:100158275-100158297 CAGTTCTGCCCAGGCTCCTCTGG + Exonic
1029825703 7:103191663-103191685 CAGTTATGTTCTTCTTGCTCAGG - Intergenic
1031230259 7:119096498-119096520 CAATAATGTCCAGGTTGATATGG - Intergenic
1031520638 7:122761185-122761207 CAGTTATGTCTGGGTTTCCCAGG - Intronic
1032886573 7:136146223-136146245 CAGTTGTCTTCAGGTTGCTGAGG - Intergenic
1033270265 7:139925098-139925120 CAGTTTTGTTCATTTTGCTCAGG + Intronic
1033638229 7:143233430-143233452 CAGTTATGTTCTTTTTGCTCAGG + Intergenic
1033770166 7:144541700-144541722 CAGTTATTTCCTAGTTGCTATGG - Intronic
1034352956 7:150429127-150429149 GGGTTCTTTCCAGGTTGCTCAGG - Intergenic
1034365273 7:150540871-150540893 CAATTAAGTCCAGGTTGCCAAGG - Intergenic
1036547088 8:9782409-9782431 CAGTTGTGTTAAGGTTGGTCAGG - Intergenic
1036971864 8:13364486-13364508 CAGATTTCTCCATGTTGCTCAGG + Intronic
1038536082 8:28353558-28353580 CAGTGATGACCAGGTGGCTATGG - Intronic
1040100341 8:43495171-43495193 CAGTTATTTCCAGATTTCCCAGG + Intergenic
1040764732 8:50893478-50893500 CTGTTATGGCCAGGCTGGTCTGG - Intergenic
1041250155 8:55925721-55925743 CAGTTATGGCCAGGTTCCTGAGG + Intronic
1041648098 8:60274290-60274312 CAGTCTTGTTCATGTTGCTCTGG - Intronic
1042898832 8:73700821-73700843 CAGTTATGTTCTTTTTGCTCAGG - Intronic
1043101913 8:76058290-76058312 CAGTGAAGTCCAGGCTGCTAAGG + Intergenic
1050404908 9:5297718-5297740 CAGTTTTGTCCTTGTTGCCCAGG - Intergenic
1052480815 9:29023127-29023149 CGGTTGTGTCCAGGTCTCTCTGG - Intergenic
1052935017 9:34085764-34085786 CAGCTGTGTCCAGCTTGCCCTGG + Intergenic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1058004210 9:99898034-99898056 CAGTTTTGGCCATGTTGCCCAGG - Intergenic
1059089456 9:111340221-111340243 CAGTTCTGTCCAGGGCGATCAGG + Intergenic
1060452465 9:123756101-123756123 CAGGTTTCTCCATGTTGCTCAGG + Intronic
1060909340 9:127336836-127336858 CAGTTGTGGCCCTGTTGCTCTGG + Intronic
1062003228 9:134227152-134227174 CAGCTATGTCCAAGATGGTCTGG - Intergenic
1062465101 9:136677423-136677445 CCATCATGTCCAGGATGCTCTGG + Exonic
1185944428 X:4358495-4358517 TCCTTATGTCCAGATTGCTCAGG + Intergenic
1186559367 X:10594532-10594554 CAGTGATTTCCAGGTTGATTGGG + Intronic
1186724795 X:12345497-12345519 CAGTTCTATCCATGTTTCTCTGG - Intronic
1186897610 X:14020129-14020151 CAGTGATTTCCATATTGCTCAGG + Exonic
1188728556 X:33616083-33616105 CAGTTTTGTTCATTTTGCTCAGG - Intergenic
1189872094 X:45394566-45394588 CAGTGAAGTCCAGGCTGCTGAGG - Intergenic
1189886243 X:45547397-45547419 CAGTAAAGTCCAGGCTGCTGAGG - Intergenic
1193390657 X:80924261-80924283 CAGTTATGTTCTTTTTGCTCAGG + Intergenic
1193765428 X:85523028-85523050 CAGTTTTGTACATTTTGCTCAGG + Intergenic
1194429038 X:93777801-93777823 CTGTATTGTCCAGGCTGCTCTGG - Intergenic
1194511243 X:94797831-94797853 CAGTTATGTTCTTCTTGCTCAGG + Intergenic
1195336852 X:103863554-103863576 GAGTTTTTGCCAGGTTGCTCAGG + Intergenic
1196030487 X:111091121-111091143 CAATTAAATCCAGGTGGCTCTGG - Intronic
1196832277 X:119785043-119785065 CAGCTATGTCCAGGCAGCACAGG + Intergenic
1198805648 X:140491519-140491541 CAGTTATCTCAAGGTTCCACTGG - Intergenic
1199690331 X:150304747-150304769 CACGTATCTCCAGGGTGCTCGGG - Intergenic
1200021533 X:153214772-153214794 CAGTTTTGTCCAGGCTTCTGAGG - Intergenic
1200435874 Y:3149726-3149748 CAGTTTTGTCCATTTTGCTTAGG + Intergenic
1200802194 Y:7397061-7397083 CATTTATGTTCAGGTTCTTCTGG - Intergenic
1200899341 Y:8412380-8412402 CAGTTATGTTCACGTGGCTAAGG + Intergenic
1200969122 Y:9131306-9131328 CAGTCATGTTCAGGTTCTTCAGG + Intergenic
1202141706 Y:21731193-21731215 CAGTCATGTTCAGGTTGTTCAGG - Intergenic
1202145159 Y:21772609-21772631 CAGTCATGTTCAGGTTGTTCAGG + Intergenic