ID: 1181131173

View in Genome Browser
Species Human (GRCh38)
Location 22:20733289-20733311
Sequence CTGTGGGCAGTGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1173
Summary {0: 3, 1: 2, 2: 11, 3: 119, 4: 1038}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181131173_1181131187 29 Left 1181131173 22:20733289-20733311 CCCTCCTCCCTCACTGCCCACAG 0: 3
1: 2
2: 11
3: 119
4: 1038
Right 1181131187 22:20733341-20733363 ACTTGTGGCAGATCAGGGCAAGG 0: 3
1: 0
2: 1
3: 16
4: 160
1181131173_1181131186 24 Left 1181131173 22:20733289-20733311 CCCTCCTCCCTCACTGCCCACAG 0: 3
1: 2
2: 11
3: 119
4: 1038
Right 1181131186 22:20733336-20733358 GCTGCACTTGTGGCAGATCAGGG 0: 3
1: 0
2: 0
3: 12
4: 155
1181131173_1181131183 14 Left 1181131173 22:20733289-20733311 CCCTCCTCCCTCACTGCCCACAG 0: 3
1: 2
2: 11
3: 119
4: 1038
Right 1181131183 22:20733326-20733348 TTCCACTGAAGCTGCACTTGTGG No data
1181131173_1181131185 23 Left 1181131173 22:20733289-20733311 CCCTCCTCCCTCACTGCCCACAG 0: 3
1: 2
2: 11
3: 119
4: 1038
Right 1181131185 22:20733335-20733357 AGCTGCACTTGTGGCAGATCAGG 0: 3
1: 0
2: 1
3: 13
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181131173 Original CRISPR CTGTGGGCAGTGAGGGAGGA GGG (reversed) Intronic
900356494 1:2267555-2267577 CTGAGGGCACTGAGGGAGTGGGG + Intronic
900482646 1:2906681-2906703 CTCAGGGGAGGGAGGGAGGAAGG + Intergenic
900522242 1:3111317-3111339 CACTGGGCAGTGGGGGAGGCAGG + Intronic
900740409 1:4327569-4327591 CTGTGGGCAGTGTGGGGAGAAGG - Intergenic
900763010 1:4485607-4485629 CTGACGGCTGAGAGGGAGGAAGG + Intergenic
900946467 1:5833955-5833977 CTGTGGTCAGTGGCGGAGCAGGG - Intergenic
900950264 1:5854656-5854678 CTGGGGGCTGTTAGGGAAGAAGG - Intergenic
901024064 1:6269902-6269924 CCCTGGGCACTCAGGGAGGAAGG - Intronic
901052078 1:6430270-6430292 GGGTGAGCACTGAGGGAGGAAGG + Intronic
901144098 1:7053625-7053647 CAGAGTGGAGTGAGGGAGGAAGG - Intronic
901155392 1:7134043-7134065 CTGGGGGGAGTCAGGGAGGGAGG - Intronic
901190162 1:7405124-7405146 CTGCAGGAAGTGAGGGAGGAGGG - Intronic
901544732 1:9947406-9947428 CATGGAGCAGTGAGGGAGGAAGG - Intronic
901817785 1:11804914-11804936 CTGTGGGGAGTGAGGAACGGGGG + Intronic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902181908 1:14695824-14695846 CTATGGCCAGTGAGGGAGAGTGG - Intronic
902188896 1:14746640-14746662 CTGGGGTCAGGGAGGGAGGGTGG + Intronic
902292190 1:15442603-15442625 CTGGGGGCAGTGTGGAAGGAGGG + Intronic
902394512 1:16125321-16125343 CTGTGGGCCGGGAGGGAGAGAGG + Intronic
902416480 1:16242716-16242738 CCCTGGGGAGTGAGGGAGGGTGG + Intergenic
902444441 1:16452961-16452983 CTGTGGGGAGAGTGGCAGGAGGG + Intronic
902542948 1:17167214-17167236 CTGTGGCCAGGAAGGGAGGGAGG - Intergenic
902727545 1:18347165-18347187 CTGTGTTCAGAGAGGGAGGGAGG - Intronic
903228065 1:21904920-21904942 CTGTGGGCAGTGACCCAGGAGGG - Intronic
903333979 1:22612854-22612876 CCGTGGAGAGGGAGGGAGGAGGG - Intergenic
903335566 1:22622037-22622059 CTGTGGAGAGTGGGGGATGAGGG + Intergenic
903651494 1:24925250-24925272 CGGTTGGCAGGGAGGAAGGAGGG - Intronic
903778238 1:25806584-25806606 CTGTAGGCGGGGAGGGAGTAGGG + Intronic
903971953 1:27124730-27124752 CTGAGGGCAGTGATGAAGAAGGG + Intronic
903996482 1:27308065-27308087 CAGGGGGCAGGGAGGGAGGGTGG - Exonic
904016866 1:27428491-27428513 CTGTGGGAAGGGTGGCAGGAAGG - Intronic
904573074 1:31482525-31482547 CTGTGGGGAATAAGGGAGAAAGG + Intergenic
904799539 1:33082597-33082619 ATGTGGGCGGTGAGGGAGAGGGG - Intronic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905240299 1:36576775-36576797 CTGGGGTCGGGGAGGGAGGAGGG + Intergenic
905361074 1:37420836-37420858 CTGTGGATACTGAGGGATGATGG - Intergenic
905408565 1:37753434-37753456 ATGGGGTCAGTCAGGGAGGAAGG + Intronic
905427180 1:37895498-37895520 CTGTGGGGAGAGAGAGAGGGAGG - Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
905920824 1:41717545-41717567 CTGGGTGAAGTGAGGGAGCAGGG + Intronic
906278965 1:44540180-44540202 ATGTGGGCAGTGGTTGAGGAAGG - Intronic
906293110 1:44632432-44632454 CGGCAGGCAGTGAGGGAGGGAGG - Intronic
906294621 1:44641891-44641913 CGCTGGCCAGTGAGGCAGGATGG - Intronic
906652043 1:47519755-47519777 GTGTGGGCAGGGAGGGAGGGTGG + Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907523137 1:55038191-55038213 CTGAGGGAGGTGGGGGAGGAAGG - Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908389108 1:63669469-63669491 CTGGGGGCATTGAAGGAGGGCGG - Intergenic
908682815 1:66681800-66681822 GTGTGGGGAGTGAGGGAGGGAGG - Intronic
909007494 1:70294302-70294324 CTGTGGGCAGTGGCCAAGGAGGG + Intronic
909046987 1:70722378-70722400 CTGTTGGGAGTGAGGGTGGAGGG - Intergenic
910503287 1:87919254-87919276 CTGTGGGGAGTAAGGAAGGTAGG + Intergenic
910670676 1:89769652-89769674 CTGCCTGCAGTGAGAGAGGAAGG - Intronic
910689825 1:89954564-89954586 CCTTGGGCAGTGAGGGCTGATGG - Intergenic
910846797 1:91611922-91611944 ATGGGGGCAAGGAGGGAGGAGGG + Intergenic
911724133 1:101223908-101223930 CTTTGGGAAGTGATTGAGGATGG + Intergenic
912364033 1:109118216-109118238 CAGTAGGCAGAGATGGAGGAAGG + Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912936577 1:114008269-114008291 ATGAAGGCAGTGAGGGAGGCTGG + Intergenic
913056236 1:115162788-115162810 CTCTGAGGAGGGAGGGAGGAGGG - Intergenic
913320219 1:117582721-117582743 CTGTGGGCAGTGGGGGAGGATGG + Intergenic
913367369 1:118055115-118055137 CTGTGGGCAGAAGGGGAAGATGG - Intronic
913474226 1:119221413-119221435 CTGTAGGGTGTGGGGGAGGAGGG - Intergenic
913556453 1:119971972-119971994 ATGAGGGAAATGAGGGAGGAAGG + Intronic
914377798 1:147087887-147087909 CTTTGGGAGGTGAGGCAGGAGGG - Intergenic
914675283 1:149903472-149903494 ATGTGGGGAGTGAGGGACAAGGG + Exonic
914806312 1:150994752-150994774 CTGTGTGCAGGGAGTGAGGGTGG - Intronic
915140465 1:153764771-153764793 GTGTGTGCTGTCAGGGAGGATGG - Intronic
915227739 1:154423161-154423183 CAGTGGGCACTGAGGGATGTCGG - Intronic
915229693 1:154436117-154436139 CGGTGGGCACTGAGAAAGGAAGG + Intronic
915300966 1:154951435-154951457 CTGTGGGAAGGAAGGGAGGCGGG - Intronic
915311571 1:155008132-155008154 CTGTGGGCACCGAAAGAGGAAGG - Intronic
915466127 1:156099079-156099101 CCGTTGGCAGGGAGGGAGGCAGG + Intronic
915530814 1:156501036-156501058 CTGCCGGGAGGGAGGGAGGAAGG + Intergenic
915557067 1:156666741-156666763 GAGTGGCCAGTGGGGGAGGAGGG - Intergenic
915655126 1:157353027-157353049 CTTGGGGGATTGAGGGAGGAGGG - Intergenic
917711248 1:177687602-177687624 CTGTGGGAAGTGAGGGAGGTAGG + Intergenic
917711380 1:177688675-177688697 CTGTGGGAAGTGAGGGAGGGTGG + Intergenic
917712782 1:177704231-177704253 TTAGGGGCAGTGAGGCAGGAGGG - Intergenic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918237881 1:182597957-182597979 CTGTGAGCACTGAGGGAGGGAGG - Intergenic
918533765 1:185551657-185551679 CTTTGGGAGGTGAGGGAGGGTGG + Intergenic
918742754 1:188156053-188156075 CATGGGGCAGTGAGGGAAGAAGG + Intergenic
918914959 1:190623075-190623097 TTGTGGGGGGTGAGGGAGGTGGG + Intergenic
919972793 1:202591708-202591730 CTGTGGGTGGTGATGGAGGAGGG - Exonic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920370943 1:205478955-205478977 GGGAGGGCAGGGAGGGAGGAGGG + Intergenic
920498803 1:206473394-206473416 CAGTGGGCATTGAGGGTGGTGGG + Intronic
920692316 1:208156014-208156036 ATGTGGCTGGTGAGGGAGGATGG + Intronic
920904047 1:210142755-210142777 CAGTGGGAAATGGGGGAGGAAGG - Intronic
921056047 1:211543153-211543175 CTGTGGGCAGTGAGGGTGAATGG + Intergenic
922490664 1:226013970-226013992 CAGTGTGCAGTGCGGGCGGAAGG - Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923035049 1:230279809-230279831 CTGAGGACAGGGCGGGAGGAGGG + Exonic
923076164 1:230610556-230610578 CTGTTCTCAGTGAGGGAGAAGGG + Intergenic
923188593 1:231597859-231597881 ATTTGGGGAGTGAGGGTGGAAGG + Intronic
923211717 1:231809296-231809318 CTCTGGCCAGTGAGGGAGCCTGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923608198 1:235464493-235464515 ATGTGGGAAGTGAGGGAGGGAGG - Intronic
924064322 1:240207773-240207795 CTCCGGGAAGTGGGGGAGGAGGG - Exonic
924181276 1:241440635-241440657 CGGTGGGGAGGGAGGGAGGGAGG + Intergenic
924412916 1:243825239-243825261 CTGTGGCCTGTCAGGGATGAGGG + Intronic
924467545 1:244312110-244312132 CTCTGGGCAGAAAGGGAGGCTGG + Intergenic
1062816987 10:508114-508136 CTCTGTGGCGTGAGGGAGGAAGG - Intronic
1063072482 10:2680262-2680284 CTCTGGGGAGTGAAGCAGGAAGG + Intergenic
1063298270 10:4827465-4827487 CTGGGGGAGGTGAGGAAGGAGGG - Intronic
1063306744 10:4909700-4909722 CTGTGGCCATTGAGGTAGGGTGG - Intergenic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1063542784 10:6950951-6950973 CTATGGGCAGGGAGGGAGCTGGG + Intergenic
1063702586 10:8400110-8400132 GTGTGTGAAGTGAGGCAGGAAGG + Intergenic
1063972752 10:11392944-11392966 CTGTGGGCAGTGCAGGTGGCCGG + Intergenic
1063981637 10:11457402-11457424 CTGGGGGCAGTGAGGGAGACAGG - Intronic
1064227821 10:13503169-13503191 CAGGTGGCAATGAGGGAGGAAGG + Intronic
1064648306 10:17482599-17482621 CATGGGGCAGTGAGTGAGGAAGG + Intergenic
1064868019 10:19904422-19904444 CTGTGGGCTGTGTGGGAGTGGGG - Intronic
1064965099 10:21007198-21007220 CTGTGGGGAGAGAGGGTGAATGG - Intronic
1065132428 10:22635665-22635687 CTGTGGGCAGCGAGGAAGCATGG + Intronic
1065363179 10:24908702-24908724 CATGGAGCAGTGAGGGAGGAAGG + Intronic
1065553195 10:26889142-26889164 CTTTGGGCAGCCAAGGAGGATGG + Intergenic
1065791706 10:29266298-29266320 ATGTGGGCGGTGCGGGGGGATGG - Intergenic
1065918608 10:30372008-30372030 ATATGGGGAGTGGGGGAGGAAGG - Intronic
1066220968 10:33335912-33335934 CTGTGGGAAGTGGGGGTGGCAGG - Intronic
1066306088 10:34142582-34142604 CGGGGGGCAGGGAGGGAGGGAGG + Intronic
1066995468 10:42559185-42559207 ATTTGATCAGTGAGGGAGGAGGG - Intergenic
1067061102 10:43078299-43078321 TTGTAAGGAGTGAGGGAGGATGG - Intronic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1069040111 10:63687147-63687169 CAGTGGGCAGTGGGGGCGGGGGG - Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069445730 10:68471770-68471792 CTGTGAGCGGAGAGGGGGGAGGG - Exonic
1070686625 10:78489527-78489549 CTGTGGGCAGTGAAGATGGAAGG - Intergenic
1070920976 10:80186277-80186299 CTGTGGGGACTGAAGGGGGAAGG + Intronic
1070979760 10:80634599-80634621 CTCTGGGCAGTGGGGCTGGAGGG + Intronic
1071083696 10:81842794-81842816 CTTTTTGCAGTGAGAGAGGAAGG - Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071917996 10:90317564-90317586 GTGTGGGCAGAGAGGTAGGCAGG + Intergenic
1072254981 10:93612921-93612943 CTGTGGACCGTGCAGGAGGAGGG + Exonic
1072461779 10:95625635-95625657 AGGTTGGCAGTGAGAGAGGAAGG - Intronic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1073444855 10:103574560-103574582 CTGAGGTCAGTGGGGGAGGATGG + Intronic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1074349177 10:112717966-112717988 CTGTGGGAAGGGAGCAAGGAAGG - Intronic
1075216389 10:120539801-120539823 TTGGGAGGAGTGAGGGAGGAAGG + Intronic
1075310651 10:121411004-121411026 CATAGAGCAGTGAGGGAGGAAGG - Intergenic
1075455425 10:122581932-122581954 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075457548 10:122594635-122594657 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075458629 10:122601130-122601152 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459260 10:122605189-122605211 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075459892 10:122609248-122609270 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075460524 10:122613307-122613329 CTGTGGGTTGCGTGGGAGGAAGG + Intronic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1076214245 10:128679969-128679991 CTGGAGGCAGAGAGGAAGGAAGG + Intergenic
1076320867 10:129580478-129580500 CCGTGGGCTTTGAGCGAGGAAGG + Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076670847 10:132120424-132120446 CTGTGGTCAGGGGTGGAGGAAGG - Intronic
1076726612 10:132416893-132416915 CTGTGGGCCCTGAGGGAAGGAGG + Intronic
1076823346 10:132953171-132953193 GTGTGGGCAGTGGAGGAGGTGGG + Intergenic
1076882389 10:133245844-133245866 CTGCGGGCTGTGAGGGAGGTGGG + Intergenic
1077230207 11:1455312-1455334 CTGGGGGCGGTGGGGGAGGCGGG - Intronic
1077533630 11:3108538-3108560 CTGTGGGCAGCGGTGGAGCAGGG + Intronic
1077774795 11:5258847-5258869 CTGTGGCTACTGTGGGAGGATGG - Intronic
1077906870 11:6541098-6541120 CTGTGTGGAGAGAGGGAGGTGGG + Intronic
1077915897 11:6611474-6611496 CTGTCAGCAGAGCGGGAGGAGGG + Intronic
1077958640 11:7049002-7049024 GTGAGGGGAGTGAGGGTGGAGGG + Intronic
1078085666 11:8231796-8231818 CTGGGGGCAGTGAGGAGGGCTGG - Intronic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1079012683 11:16842341-16842363 CATGGAGCAGTGAGGGAGGAAGG - Intronic
1079103892 11:17558439-17558461 CTGTGGGGAGAGGGAGAGGAAGG - Intronic
1079135394 11:17773551-17773573 CTGGGGGCCGGGAGGGGGGAGGG + Intronic
1079244786 11:18744098-18744120 CTGAGGGCGGCGAGGGAGGAGGG + Exonic
1079642004 11:22817129-22817151 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
1079803036 11:24895504-24895526 GAGTGGGGAGTGAGGGAGGCAGG - Intronic
1080042209 11:27770789-27770811 CTCTGGACAGCCAGGGAGGAAGG - Intergenic
1080084477 11:28261409-28261431 CATGGAGCAGTGAGGGAGGAAGG + Intronic
1080241165 11:30128656-30128678 CTGAGGGCAGTGATGTGGGAAGG + Intergenic
1081662405 11:44896114-44896136 CTGGGTGGATTGAGGGAGGAAGG + Intronic
1081691316 11:45080439-45080461 CTGTAGGCAGGGGGTGAGGATGG - Intergenic
1081734634 11:45394337-45394359 ATGTGGGGAGTGAGGAAGGCGGG + Intergenic
1081911381 11:46701881-46701903 GTGTCAGCAGTGAGTGAGGAAGG + Intronic
1081994161 11:47352867-47352889 CTGCGGGGGGTGAGGGGGGAAGG - Intergenic
1083260792 11:61521761-61521783 CTCAGGGCAGTCATGGAGGAAGG - Intronic
1083290035 11:61684723-61684745 CTGTGGGAAGTGAGGGCGGAGGG + Intronic
1083319214 11:61834996-61835018 CTGGGGGCAGGCAGGGAGGAGGG - Intronic
1083489284 11:63003324-63003346 CAGTTGGAAGTGAGGGAGAATGG + Intronic
1083589470 11:63884850-63884872 CTGGATACAGTGAGGGAGGAAGG + Intronic
1083597856 11:63927772-63927794 CTGGGGGCAGTTAGGGAGCTGGG - Intergenic
1083909564 11:65698176-65698198 TTGAGGGGAGTGAGGGAGGGTGG - Intergenic
1084084304 11:66847845-66847867 CTGTGGGCAGGTGGGCAGGAGGG + Intergenic
1084115742 11:67042002-67042024 CTGTGAGCAGAGTGCGAGGAGGG + Intronic
1084190699 11:67497430-67497452 CTGAAGGCTGTGGGGGAGGAGGG + Exonic
1084192070 11:67503941-67503963 CTGTGGGAAGAGGGGCAGGAGGG - Intronic
1084216557 11:67650066-67650088 CTGTGGGGAGTGAGGAACAAAGG + Intronic
1084219700 11:67670457-67670479 CTGAGGGCAGTGGGGGTGGGTGG + Intronic
1084263946 11:67995578-67995600 CTGTGGGCACTGGGGGGGGGGGG - Intronic
1084368608 11:68721269-68721291 CTGTGGCAAGAGAGGGAGGGTGG - Intronic
1084809469 11:71603545-71603567 CTGTGGGCACTGGGGGGGGCGGG + Intergenic
1084859518 11:72009186-72009208 CTGTGGGCAGAGAGGGTGGGTGG + Intronic
1084970344 11:72768126-72768148 CTGTGGGCTGTGAGGGTAGAGGG - Intronic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085023378 11:73222680-73222702 AGGTGGGCAAAGAGGGAGGAGGG - Intronic
1085073551 11:73571231-73571253 CTGTGGGGAGGGGGGGGGGAGGG - Intronic
1085473239 11:76771481-76771503 TGGTGGGCAGTGAGGCTGGATGG + Intergenic
1085804566 11:79623245-79623267 CTGTGGGAATTGATAGAGGAAGG - Intergenic
1086547848 11:88018998-88019020 AAGTGGTCAGTGAGGTAGGAGGG - Intergenic
1086819994 11:91424103-91424125 CTGTGGGGAGTGGGGGGTGAGGG - Intergenic
1087353700 11:97066506-97066528 GAGTGGGGAGAGAGGGAGGATGG + Intergenic
1087425919 11:97985242-97985264 CTGAGGGCAGGGAGGGAGACAGG + Intergenic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1087670678 11:101102846-101102868 CTGGGGGCAGTGAGGGGTGGGGG + Intronic
1088315185 11:108499277-108499299 CAGAGGGCTGTGAGGGAGGGCGG - Intergenic
1089118102 11:116112494-116112516 CTGTGGGTGATGAGGGTGGAGGG + Intergenic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1089676720 11:120095412-120095434 ATGGGGGCAGTGAGGGTTGATGG + Intergenic
1089759966 11:120716008-120716030 ATGTGGGCAGTGGGGGAAGGCGG + Intronic
1090003515 11:122981366-122981388 GTATGGGCAGTGAGAGAGCAGGG - Intronic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090552010 11:127830115-127830137 CTGTGGTAAGTCAGGCAGGATGG - Intergenic
1090579995 11:128148986-128149008 GTGGGGACAGTGAGGGAGGCTGG + Intergenic
1090766462 11:129880331-129880353 CTGTGGGGAATGAAGGAGAATGG - Intronic
1091097491 11:132837860-132837882 CCCTGAGCAGTGAGGGAGGAGGG - Intronic
1091764128 12:3107182-3107204 CCGTGGGGAGTGGGGGAGGGAGG + Intronic
1091898117 12:4120803-4120825 CAGAGGGCAGTGACGGGGGATGG + Intergenic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092124434 12:6065592-6065614 CAGTGAGCTGTGAGGGAGGAGGG - Intronic
1092802899 12:12188357-12188379 AGATGGGCAGAGAGGGAGGAAGG + Intronic
1092968903 12:13672578-13672600 CTGTGGGCAGGGAGGATGGCAGG - Intronic
1093055712 12:14553860-14553882 CATGGAGCAGTGAGGGAGGAAGG + Intronic
1093276313 12:17132495-17132517 CTGTGGGCCATGACGGAGGAGGG + Intergenic
1093484865 12:19641684-19641706 GTGTGGTCTGTGGGGGAGGAAGG - Intronic
1093958824 12:25251045-25251067 CTGAGGGCGGTGTGGGAAGAGGG + Intergenic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094202285 12:27806280-27806302 CATGGAGCAGTGAGGGAGGAAGG + Intergenic
1094362849 12:29649017-29649039 ATGTGGGCAGAGGTGGAGGATGG - Intronic
1094480059 12:30874543-30874565 CTGGGGGCAGTGAGTGGGGTGGG - Intergenic
1094488668 12:30945105-30945127 CTGAGGGCAGAAAAGGAGGAGGG - Intronic
1095620771 12:44250832-44250854 GTGTGGGCAGTGTGGGGCGAGGG + Intronic
1095980819 12:47973770-47973792 CTGTGGGGAGTGGGGAAGGAGGG - Intronic
1096238454 12:49945560-49945582 CTTTGGGGACTGAGGGAGAAGGG - Intergenic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096696947 12:53355331-53355353 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
1096861684 12:54533296-54533318 GTAGGGGCAGAGAGGGAGGATGG + Intronic
1096883077 12:54688344-54688366 CAGTGTCCAGTGAGGGAGCAAGG + Intergenic
1097270024 12:57768329-57768351 CAGTGGGGAATGAGGGAGTAAGG - Intronic
1097297089 12:57978164-57978186 CATGGAGCAGTGAGGGAGGAAGG + Intergenic
1097745918 12:63302898-63302920 CTGTGGGCAGTGGAAGAGAATGG - Intergenic
1097793652 12:63841136-63841158 CTGTTGGCAGTGTAGAAGGATGG - Intergenic
1097806139 12:63967090-63967112 CTGTGAGCCGTTTGGGAGGAGGG + Intronic
1098065703 12:66614041-66614063 GTGTGGTCAGTGAGGCAGGTGGG - Intronic
1098620635 12:72593663-72593685 CTGTCAGCAGGGTGGGAGGAGGG - Intronic
1098918022 12:76277156-76277178 CTGTGGGGAGGTGGGGAGGAAGG - Intergenic
1099535887 12:83844129-83844151 CTGTGCGAAGTAAGGGAGTAAGG + Intergenic
1100627857 12:96354944-96354966 CTATGGGCAGTGGGGCAGGGAGG - Intronic
1100918529 12:99455604-99455626 CTGTGGGCTGTGTGGGAGTTGGG + Intronic
1101059371 12:100954989-100955011 CTGTGGGCAGTTATGGTGGAAGG - Intronic
1101348527 12:103907058-103907080 CTGTTGGAAGGGAGGAAGGAAGG + Intergenic
1101693559 12:107103401-107103423 CTGAGGGCAATGAGGGAGGGAGG - Intergenic
1102396016 12:112586439-112586461 CTGGATGCAGTGAGGGAGTAAGG + Intronic
1102474084 12:113177380-113177402 CTGGGGGCACTGTGGGTGGAAGG - Intronic
1102581324 12:113890116-113890138 TTTTGGGCAGCGAGGGAGGGGGG - Intronic
1102691270 12:114763015-114763037 GTGGGGGCAGGGAGGGTGGAAGG - Intergenic
1102912562 12:116728760-116728782 CTGTGGGCCTTGAGGGAGTTGGG - Intronic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103774168 12:123353161-123353183 TTTTGGGCAGGGAGTGAGGAAGG + Intronic
1104437488 12:128767385-128767407 CAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1104715534 12:131013627-131013649 GTGTGGGCTGTGAGCGGGGAAGG + Intronic
1104728899 12:131094403-131094425 CTGTGGGCACCGGGGCAGGACGG + Intronic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104837967 12:131804152-131804174 CTGGGGGCTGTGAGTGAGAAGGG + Intergenic
1104948715 12:132429177-132429199 GTGTGGTCAGGGAGGGAGGAGGG - Intergenic
1105587275 13:21756847-21756869 CAGGGGGCAGGGAGAGAGGAAGG - Intergenic
1105603588 13:21908949-21908971 CTGTGGGCAGTGCCTGAGCACGG + Intergenic
1106577855 13:30992609-30992631 CTGGTGGAAGTGTGGGAGGAGGG + Intergenic
1107080731 13:36372173-36372195 GTGTGGGCAGAAAGGGAGGTAGG - Intergenic
1107139710 13:36984741-36984763 CGGTGGGAAGGCAGGGAGGAGGG + Intronic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1108068979 13:46607949-46607971 CTGAGGGCAGGGAGGGATGTGGG + Intronic
1108275420 13:48804470-48804492 ATGTGCTCAGTGAGGGAGGGAGG + Intergenic
1108285833 13:48907106-48907128 GTGTGGGCAGTGAGGTCTGAGGG - Intergenic
1109184615 13:59253463-59253485 CTGAGGGCAGTGAGAAGGGAGGG + Intergenic
1109215218 13:59582392-59582414 CTGTGGGCAGAAAAGGAGTAAGG - Intergenic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1110889793 13:80684720-80684742 AGGTAGGGAGTGAGGGAGGAAGG - Intergenic
1111825375 13:93261181-93261203 ATATGGGCAGTTAGGGAGAAGGG + Intronic
1111893001 13:94106520-94106542 GTGAGGGAAGTGAGGGAGGATGG + Intronic
1112742533 13:102491502-102491524 CTGTGGGCACTCAGGGAGAAAGG + Intergenic
1112775372 13:102837895-102837917 CTGAGGGCAGTCTGGGAGGCGGG + Intronic
1113391614 13:109903318-109903340 ACGTGGGGAGTGCGGGAGGAAGG + Intergenic
1113508368 13:110832194-110832216 GCTTGGGCAGTGAGGGAGGGAGG - Intergenic
1113594616 13:111522059-111522081 GTGTGGCCAGTGGGGTAGGATGG + Intergenic
1113776391 13:112948084-112948106 CTGTGGGCAGTGAGGTTGCATGG + Intronic
1113850813 13:113416929-113416951 GTGTGTGCAGTGAGAGATGAGGG + Intergenic
1113865275 13:113517855-113517877 TTGTGGGGAGTGTGGGTGGAGGG + Intronic
1113952088 13:114077655-114077677 CGTTGGGCAGGGAGGGAGGGAGG - Intronic
1114257999 14:21018726-21018748 TTGGGGTGAGTGAGGGAGGAGGG - Intronic
1114673493 14:24427215-24427237 CTGTGGCTGGTGAGGAAGGAAGG - Exonic
1115139564 14:30154617-30154639 CTGTGAGAAGTTAGGGAAGATGG - Intronic
1115438723 14:33407202-33407224 CTGTGGGCAGTTACAAAGGATGG - Intronic
1115450424 14:33541500-33541522 CTGTGGGCAGTGATCAGGGATGG - Intronic
1115569840 14:34656048-34656070 CTGTGGCCAGAGAGTGAGGATGG + Intergenic
1115727336 14:36231672-36231694 CATGGGGCAGTGAGGGAGGAAGG + Intergenic
1116034857 14:39615543-39615565 CTGTGTGCCCTGAGAGAGGATGG + Intergenic
1116057083 14:39876985-39877007 CTTTGACCAGTGAGAGAGGAGGG - Intergenic
1116078014 14:40136942-40136964 CTGTGGCCTGTGAGTGTGGATGG + Intergenic
1116870922 14:50068655-50068677 CATAGAGCAGTGAGGGAGGAAGG - Intergenic
1116890654 14:50264727-50264749 AAGTGGGGAGGGAGGGAGGAAGG + Intronic
1117221840 14:53613899-53613921 CTGTGGGGAGTGCAGGAGGCTGG - Intergenic
1117939242 14:60943571-60943593 CAGTGGGCAGTGAGGGAGTGGGG + Intronic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118907226 14:70031796-70031818 GTGGTGGCAGTGAGGGAGGTTGG + Intronic
1119895970 14:78220336-78220358 AGGTGTGCAGAGAGGGAGGAGGG + Intergenic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1121429314 14:93875689-93875711 TTGTGGGTAGTGATGGAGAAAGG + Intergenic
1121567759 14:94923508-94923530 CTGTGGGCAGTGAAGGTGGAGGG - Intergenic
1121775035 14:96584754-96584776 CTGTGAGGACTGAGGGAGGGTGG + Intergenic
1122122288 14:99561009-99561031 CTGTGGAGACTGAGGGAGGCAGG - Intronic
1122123708 14:99568086-99568108 CTTTAGGCAGAGAGGCAGGAGGG + Intronic
1122125057 14:99574464-99574486 CTGTGAGGAGTGAGTGGGGATGG - Intronic
1122343371 14:101043230-101043252 CTGGAGGCAGTGGGAGAGGAGGG + Intergenic
1122958785 14:105085088-105085110 CTGTGGGAAGTGAAGGCAGAGGG - Intergenic
1123010672 14:105348183-105348205 CTGTGGACAGGCAGGTAGGAGGG - Intronic
1123433445 15:20237523-20237545 CCGTGGGAAGTGAGGTAGGAAGG - Intergenic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1124100351 15:26687077-26687099 CTCTGGGAAGTGAGGGTGCAGGG + Intronic
1124685167 15:31776399-31776421 CTGTGGGGAGAGTGGGAGCAAGG + Intronic
1125200072 15:37095431-37095453 CTCTAGGGAGAGAGGGAGGAAGG - Intronic
1126369742 15:47933241-47933263 CTGTGGGAAGAGAGTGAGTAAGG - Intergenic
1126476917 15:49074933-49074955 CTGTGGGAGGTGAGGGGGTAGGG + Intergenic
1127410747 15:58704044-58704066 CATGGAGCAGTGAGGGAGGAAGG + Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127832769 15:62765392-62765414 CTGTGGGCCGGGAGGGATGCGGG - Intronic
1128514666 15:68334863-68334885 GTGTGGGCAGGCAGGGTGGAGGG + Intronic
1128724983 15:69981900-69981922 CTGTGGGCAGGTGGGCAGGATGG - Intergenic
1128729868 15:70013889-70013911 GTGTGGGCAGGGAGAGAGGGAGG + Intergenic
1128835238 15:70804171-70804193 GGGTGGGCAATGAGGGAGAAGGG + Intergenic
1129351769 15:74959462-74959484 ATGCGGGGAGTGAGGGAGGAAGG + Intronic
1129386967 15:75201764-75201786 CTGTGGGCAGCGGGTGCGGAGGG - Intronic
1129514516 15:76148853-76148875 TTGCGGGAAGAGAGGGAGGAGGG - Intronic
1129690815 15:77712333-77712355 CCAAGGGCAGTGAGGGCGGAAGG - Intronic
1129692351 15:77721046-77721068 ATGTGAGCATTGAGGCAGGAGGG - Intronic
1129858862 15:78844645-78844667 CTGTGGCCAGTGAATGAGGATGG - Intronic
1129930610 15:79407507-79407529 CTGGAGGCAATGAGGGAAGACGG + Intronic
1129937509 15:79463163-79463185 ATGTGGGCCTTGAGGGAGGCAGG - Exonic
1130172657 15:81531692-81531714 CAGTGGGCACTGAGGGAGGAGGG - Intergenic
1130293916 15:82629575-82629597 CTGTGGAGAGTGAGGGAGACCGG - Intronic
1130368889 15:83266252-83266274 GTGTGGGGAGGGAGGGAGGGAGG + Intronic
1130919933 15:88335445-88335467 CTGTGGGAACTCAGGGAGCAGGG + Intergenic
1131055071 15:89370231-89370253 CGTTGGCCGGTGAGGGAGGAAGG - Intergenic
1131116636 15:89800005-89800027 ATGAGAGGAGTGAGGGAGGAGGG - Intronic
1131341405 15:91605140-91605162 CTGTGGGGAGTGATGAGGGAAGG + Intergenic
1131390507 15:92044211-92044233 TTGTGGGCACTGAGATAGGAGGG - Intronic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132386126 15:101401239-101401261 GCGTGGGCAGCGATGGAGGATGG + Intronic
1132671150 16:1102779-1102801 CTGTGGGAGGTGAGGGGGGCTGG - Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132943081 16:2518116-2518138 CTGTGGGCAGAGAGGGGGCAGGG + Intronic
1133883801 16:9807320-9807342 GTGGGGGGAGAGAGGGAGGAAGG + Intronic
1133913648 16:10088444-10088466 CTCAGGGCTGTGAGTGAGGATGG + Intronic
1133965340 16:10527011-10527033 CTTTGGGAAGTGAAGGCGGAAGG - Intergenic
1133993371 16:10728059-10728081 GTGTGGGCAGTGGAGGAGGAGGG + Intergenic
1134005231 16:10814592-10814614 CTCAGGGCAGTGATGGAGGCTGG - Intronic
1134422784 16:14110394-14110416 CTGAAGGCAGTCAGGGAGGTAGG + Intronic
1134444474 16:14320458-14320480 CTGTGGGCGCTTAGGGAAGAAGG - Intergenic
1134504001 16:14790798-14790820 CTGAGGTCAGGGAGGGAGGCAGG + Intronic
1134576571 16:15338110-15338132 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1134725868 16:16418389-16418411 CTGAGGTCAGGGAGGGAGGCAGG + Intergenic
1134941565 16:18293470-18293492 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1135181842 16:20281592-20281614 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1135583679 16:23650427-23650449 GTGTGGGGAGGGAGGGAGGCAGG - Intronic
1135730673 16:24892542-24892564 CTGTGGGCAGGGAGGCAGGGCGG + Intronic
1136165012 16:28447970-28447992 CTGTGGAAAGTGAGAGAGGAAGG - Intergenic
1136197955 16:28667010-28667032 CTGTGGAAAGTGGGAGAGGAAGG + Intergenic
1136214300 16:28781187-28781209 CTGTGGAAAGTGAGAGAGGAAGG + Intergenic
1136259022 16:29061032-29061054 CTGTGGAAAGTGGGAGAGGAAGG + Intergenic
1136659978 16:31749184-31749206 CTGTGCACAGTGAGAAAGGATGG + Intronic
1136851181 16:33613605-33613627 CCGTGGGAAGTGAGGTAGGAAGG + Intergenic
1137267879 16:46884013-46884035 GTGCGGGCAGTGAGGGCGGTAGG + Intergenic
1137351730 16:47719212-47719234 CCATGTGGAGTGAGGGAGGAAGG - Intergenic
1137368581 16:47883224-47883246 CTTTGGGCACTCAGGGAGAAAGG + Intergenic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1137708591 16:50551222-50551244 TTGGGGGAAGTGAGGGAGGGTGG + Intronic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1138344462 16:56311622-56311644 ATGTCAGCAGGGAGGGAGGAGGG - Intronic
1138392843 16:56682842-56682864 CTCTGAGCAGTCAGGGTGGATGG + Intronic
1138857563 16:60712921-60712943 CTTTGGGAGGTGAGGGAGGGAGG + Intergenic
1138907413 16:61353949-61353971 CTGTGTTAAGTGAGGCAGGAAGG - Intergenic
1139521531 16:67485395-67485417 CCATGGGCAGTGATGGACGAGGG + Intergenic
1139544881 16:67645425-67645447 CTGCGGCCAGCGAGGAAGGAGGG - Intronic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1140880688 16:79195452-79195474 CTGTGGGCAGTTCCTGAGGAGGG + Intronic
1141257077 16:82412329-82412351 CAGTGGGCAGTGGGGTGGGATGG - Intergenic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141610587 16:85178876-85178898 GGGTGGGCAGGGAGGGATGAGGG + Intronic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1142024922 16:87807259-87807281 CTGGAAGCAGGGAGGGAGGAGGG + Intergenic
1142363281 16:89637165-89637187 CTGGGGGCTGTGAGGGTGGACGG + Intronic
1203112784 16_KI270728v1_random:1462066-1462088 CCATGGGAAGTGAGGTAGGAAGG + Intergenic
1142548211 17:720511-720533 CAGTAGGCTGTGAGGGAGGTGGG + Intronic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1143100410 17:4501468-4501490 CGTGGGGCAGTTAGGGAGGAAGG + Intronic
1143239680 17:5433518-5433540 AGGTGGGGAGTGAGGGAAGAGGG - Intronic
1143281428 17:5757597-5757619 TTGTGGGGAGGGTGGGAGGAGGG + Intergenic
1143327104 17:6106593-6106615 CTCTGGGGAGGGAAGGAGGATGG + Intronic
1143636133 17:8164500-8164522 CTGTGGGAGGTGAGTGAGCAGGG + Intergenic
1143659334 17:8315110-8315132 CTGTGGGGGGTGGGTGAGGATGG + Exonic
1143972659 17:10806622-10806644 TTGAGGGCTGTGAGGGAGAATGG + Intergenic
1144185214 17:12790045-12790067 GTCTGGGAAGTTAGGGAGGAGGG - Intronic
1144878013 17:18412353-18412375 CTGCGGGGAGAGGGGGAGGAGGG + Intergenic
1145154217 17:20532072-20532094 CTGCGGGGAGAGGGGGAGGAGGG - Intergenic
1145272062 17:21410071-21410093 CTGGGGGCAGTGAGGAAGCTTGG - Intronic
1145877830 17:28333243-28333265 CTGGGGGCAGTGGGGGCAGAGGG - Intronic
1145937506 17:28723522-28723544 GTGGGGGCAGTGAGGGTGGCAGG + Intronic
1145961376 17:28888234-28888256 GGGTGGGCAGTGAGGGTGGCAGG + Intronic
1146135777 17:30319670-30319692 GTGAGGGAAGAGAGGGAGGAAGG + Intronic
1146518978 17:33511594-33511616 ATGTGGGCAGTGAGACAGGGAGG - Intronic
1146916636 17:36682290-36682312 CATGGAGCAGTGAGGGAGGACGG - Intergenic
1147032294 17:37649131-37649153 GTGTAGGAAGTGAGGGAGTAAGG + Intergenic
1147178128 17:38669417-38669439 CTGCGGGCAGATAGGGTGGAGGG + Intergenic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147362931 17:39942964-39942986 CCTTGGGGAGTGAGGGAAGATGG + Intronic
1147703722 17:42411931-42411953 CAGTGGGCAGTGACTGGGGATGG + Intronic
1147746415 17:42697486-42697508 CTGTGGACAGTGAGAGTGGCAGG + Intronic
1147920491 17:43913719-43913741 CTGTGGGGCGTGGGGGAGGCTGG - Intergenic
1148094684 17:45044215-45044237 CTGAGGGCAGTGATGTAGGGGGG - Intronic
1148124197 17:45228568-45228590 GTGACGGCAGTGAGGGTGGAAGG + Intronic
1148236329 17:45971676-45971698 GTGTTGGCAGGGAGGGAGGTGGG + Intronic
1148465575 17:47863123-47863145 CTCTGGGCAGGAAAGGAGGATGG + Intergenic
1148642828 17:49201123-49201145 CTGTGGGAAATGAGGGAGAAGGG + Intergenic
1148791487 17:50175689-50175711 CTGTGGGAAGAGAGAGTGGAGGG - Intronic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1148862660 17:50612726-50612748 TTCGGGGCAGGGAGGGAGGAAGG - Intronic
1149123279 17:53196272-53196294 CTCTGGGAAGAGAGGCAGGATGG + Intergenic
1149189481 17:54042318-54042340 CGGTTGGCAGTAAGGGAGGTGGG - Intergenic
1150528632 17:65953643-65953665 CTGAGGGCTGTGTGGGAGCAGGG + Intronic
1150556905 17:66262703-66262725 CTGGGGGCAGGGATGGAGAAGGG + Intergenic
1151413857 17:73948754-73948776 CAGTGGCCAGGGAGGTAGGAGGG + Intergenic
1151445275 17:74159647-74159669 ATGTGGGCAGTGAGGAAGAGAGG - Intergenic
1151502195 17:74497700-74497722 TGGTGGGAAGTGAGGGCGGAGGG + Intergenic
1151680146 17:75618893-75618915 CTCTGGGCAGTGAGTGAAAAGGG + Intergenic
1151733058 17:75922242-75922264 CTGTGGACATTGAGGCAGGAAGG - Intronic
1151782378 17:76255928-76255950 CTCTGGGCAGTGAAGGAGACGGG + Intergenic
1152013653 17:77735771-77735793 CAGTGGGCGGGGAGGGAGGGAGG - Intergenic
1152227449 17:79098959-79098981 CTGGAGGCAGTGAGGACGGAGGG + Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152466146 17:80467574-80467596 TTGTGGGCAGTGAGGGGGTGAGG - Exonic
1152520499 17:80853225-80853247 CTGAGGTCAGTGATGGGGGAGGG - Intronic
1152577992 17:81151322-81151344 CTGGGGGATGTGGGGGAGGAGGG - Intronic
1152677714 17:81650365-81650387 GGGTGGGCAGTGGGGCAGGAGGG - Intergenic
1153045057 18:848354-848376 AAGTGGGAAGTGAAGGAGGAAGG - Intergenic
1153165398 18:2255982-2256004 CTTTGGGGAGTCAGGGAGAAAGG + Intergenic
1153532529 18:6062992-6063014 CTCTGGGGACTCAGGGAGGAAGG - Intronic
1153556691 18:6322420-6322442 ATGGAGGCAGGGAGGGAGGAAGG + Intronic
1153859353 18:9185241-9185263 CTGTAGTCAGTGAGTCAGGAGGG + Intronic
1154505333 18:15033567-15033589 TTGTGGGGAGTAAAGGAGGATGG - Intergenic
1154966903 18:21367459-21367481 GGGTGGGGAGTGAGGGAGGGTGG + Intronic
1155162329 18:23206138-23206160 CGGTGGGCAGGGAGGAAGGCAGG - Intronic
1155291380 18:24345764-24345786 CTTTAGACAGTGAGTGAGGAAGG - Intronic
1155491305 18:26404542-26404564 CTGTGGGCCATGCAGGAGGAGGG + Intergenic
1156232764 18:35170729-35170751 CAGTGGGGAGTGTGAGAGGAGGG + Intergenic
1156261063 18:35445344-35445366 TTGTGGGGAGGGAGGGAGGTGGG + Intronic
1156398938 18:36723560-36723582 CTTTTGGCAGGGAGCGAGGAGGG + Intronic
1156426008 18:37013490-37013512 CTGTGGGGAGTGAGGGGGATGGG - Intronic
1156540918 18:37909449-37909471 TTGTGGGGAGAGAAGGAGGAAGG + Intergenic
1157196378 18:45623454-45623476 CAGTGGGCAGTTGGAGAGGATGG + Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157559536 18:48636836-48636858 CTGTGGGCAGGGAGTTAGGGAGG - Intronic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1157750055 18:50170191-50170213 CAGTGGGCAGTGAGGAAAGGAGG + Intronic
1157863211 18:51160093-51160115 CTGTGGCCAGTGAGAAAGCACGG + Intergenic
1157911659 18:51622700-51622722 TCTTGGGCAGTGGGGGAGGATGG - Intergenic
1158435490 18:57432970-57432992 ATGGTGGGAGTGAGGGAGGAGGG + Intergenic
1158882337 18:61792535-61792557 CTGTGGGGAGTGAGACAAGATGG - Intergenic
1159444328 18:68522020-68522042 TTGTGAGCAGTGAGGGGTGATGG - Intergenic
1159634369 18:70787459-70787481 CTGCGGGGAGGGAGGGAGCAGGG + Intergenic
1159994998 18:74955829-74955851 GTGTGTGCAGGGAGAGAGGATGG - Intronic
1160112032 18:76042142-76042164 CTATCGGAAGGGAGGGAGGAAGG + Intergenic
1160671781 19:368468-368490 CTCTGGGGAGGGAGGGAGGGAGG + Intronic
1160970403 19:1765364-1765386 CTGCTGGCTGGGAGGGAGGATGG - Intronic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161079567 19:2303790-2303812 CTGTGGCCAATGATGGAGCATGG + Intronic
1161094197 19:2379538-2379560 CTGTGAGAGGTGAGGCAGGAAGG - Intergenic
1161183574 19:2901216-2901238 CTGGGGGCAGTTTGGGGGGACGG + Intronic
1161194355 19:2977901-2977923 CTGGGGGCAGTCAGGGACGGGGG - Intronic
1161323917 19:3653862-3653884 CTGTGGGCAGGCAGGGAGTGTGG - Intronic
1161399917 19:4062655-4062677 CTGGGGGCTGAGAGGAAGGACGG + Intronic
1161424252 19:4193830-4193852 CCGTCGGGAGGGAGGGAGGAAGG + Intronic
1161488302 19:4547797-4547819 CAAGGGGGAGTGAGGGAGGAGGG - Intronic
1161503820 19:4633221-4633243 CTAGGGGTAGAGAGGGAGGAGGG + Intergenic
1161534739 19:4812007-4812029 CGACGGGCAGAGAGGGAGGAGGG - Intergenic
1161576697 19:5058401-5058423 CTCTGAGGACTGAGGGAGGAGGG + Intronic
1161727404 19:5937793-5937815 CTGTGGGGAGAGAGACAGGAGGG + Intronic
1161814973 19:6494448-6494470 CTGAGGGGAGTGAGGCAGGGAGG + Exonic
1162171182 19:8790248-8790270 CTGAGGGGAGGGAGGGAGGGAGG + Intergenic
1162522715 19:11191471-11191493 CTGTGGCCTTTGAGGGAGGAAGG - Intronic
1162789982 19:13057815-13057837 TTGCGGGGAGGGAGGGAGGAAGG - Intronic
1162819041 19:13211893-13211915 CTGTCCTCTGTGAGGGAGGAGGG + Intronic
1163035743 19:14567884-14567906 GTCTGGGCAGTGAGGGGGTAGGG - Intronic
1163241565 19:16067035-16067057 GTGTGGGCGGTGGGGGAGGGGGG + Intronic
1163699811 19:18781526-18781548 CTGTGGCCAGTGGGGGTGGGTGG - Exonic
1163741250 19:19014390-19014412 TTGTGGGGTGTGAGGGTGGAAGG + Intronic
1163741706 19:19018102-19018124 TTGTGGGGTGTGAGGGTGGAAGG - Intronic
1164159658 19:22618059-22618081 CTGCGGGCAGTGGTGGAGGCGGG + Intergenic
1164577005 19:29411375-29411397 CTCTGAGGAGTGGGGGAGGAGGG - Intergenic
1164994910 19:32713894-32713916 CTGTGGGCAGAGTGGGTGGGTGG + Intergenic
1165103920 19:33457438-33457460 CTGTGGGCTGGCAGGGATGAGGG + Intronic
1165415680 19:35691981-35692003 CTCTGGGCAGTCAGGTAGGTAGG + Intergenic
1165828600 19:38719514-38719536 GAGTGGATAGTGAGGGAGGAAGG + Intronic
1165834086 19:38743883-38743905 CTCTGGGGTCTGAGGGAGGAGGG - Intronic
1165881272 19:39045727-39045749 TTGTGGAATGTGAGGGAGGATGG - Intergenic
1165928617 19:39342464-39342486 CGGTGGTCGGTGCGGGAGGAGGG + Exonic
1165934921 19:39383476-39383498 CTGTGGTAAGAAAGGGAGGAAGG - Intronic
1166010100 19:39935319-39935341 GTGTGGGCAGTGAGGGTGGGAGG + Intergenic
1166040359 19:40198582-40198604 CTCTGGGGAGTAAGGGAGGGAGG + Intronic
1166283813 19:41811362-41811384 CTGGGGGCAGGGAGGGATGGGGG + Exonic
1166366422 19:42280673-42280695 CTTTGTGCAGGGAGGGCGGACGG - Intronic
1166482428 19:43185433-43185455 CTGAGGGCAGTGTGGGGGGGGGG - Intronic
1166564593 19:43755727-43755749 CAGTGGGCAGAGTGGGTGGATGG + Intergenic
1166646928 19:44539072-44539094 CTGTGGACAGTAAGGGATCATGG - Intergenic
1166960043 19:46491809-46491831 CTCTGGGCAGTGGGGCAGGCGGG - Exonic
1166965292 19:46526230-46526252 CTGCCGGCAGAGAGGGAGGGAGG + Intronic
1167600454 19:50451604-50451626 CTGTAGGGTGTGAGGGAGGAGGG + Intronic
1167600482 19:50451678-50451700 CTGTAGGGTCTGAGGGAGGAGGG + Intronic
1167603757 19:50469137-50469159 GTGAGGGCAGAGAGGGAGCAAGG - Intronic
1167665491 19:50820961-50820983 GTGGGGGCAGGTAGGGAGGAGGG + Intronic
1167668901 19:50838702-50838724 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167668946 19:50838837-50838859 CTGGGGGATCTGAGGGAGGAGGG + Intergenic
1167669194 19:50839630-50839652 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167796967 19:51715872-51715894 CAGTGGGGAGTGAAGTAGGAAGG - Intronic
1168174248 19:54611927-54611949 GAGTGGGGAGAGAGGGAGGAGGG + Intronic
1168314617 19:55479190-55479212 CGGAGGGCAGTGAGGGAGCGAGG + Intronic
1168428055 19:56255457-56255479 CTGTGAGCACTGAGGCAGGTTGG - Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925546755 2:5024719-5024741 CTGTGAGGAGTGAGGGGTGAGGG - Intergenic
925732043 2:6926195-6926217 TTGAAGGCAGTGAGAGAGGAGGG + Intronic
925756847 2:7141431-7141453 CGTGGAGCAGTGAGGGAGGAAGG + Intergenic
927036741 2:19185274-19185296 CTGTGGGCTGTGTGGGAGCGGGG - Intergenic
927202273 2:20585143-20585165 CTCTGGACAGAGTGGGAGGAGGG - Intronic
927432824 2:23041444-23041466 CTGTTGGCAGACTGGGAGGAAGG - Intergenic
927865736 2:26586111-26586133 CCGGGGGCAGAGAGAGAGGAGGG - Intronic
929175262 2:38969339-38969361 CAGAGGGCTGTGGGGGAGGAAGG - Intronic
929190614 2:39136128-39136150 CAGTGGGCAGTATGGGTGGAGGG - Intergenic
929594801 2:43169416-43169438 GTGTGGTGAGTGTGGGAGGAGGG + Intergenic
929600214 2:43199985-43200007 CTGGAGCCAGGGAGGGAGGACGG - Intergenic
929938951 2:46315766-46315788 CTCTGGGCTCTGAGGGTGGAGGG + Intronic
930021058 2:47002560-47002582 CTGAGGGCAGTGAGCCAGGGAGG + Intronic
930137568 2:47917697-47917719 GTGGGGACAGTGAGGGAGGTGGG + Intergenic
930595266 2:53379850-53379872 CTGTGGACAGTGAGGGGGTCAGG - Intergenic
930688619 2:54335798-54335820 CTGTGGGCTCTAAGGGTGGATGG + Intronic
931241972 2:60461792-60461814 CCGGGGGCTGGGAGGGAGGAGGG + Exonic
931456636 2:62414634-62414656 CTTTGGGAAGTCAGGGTGGATGG + Intergenic
932421602 2:71604523-71604545 CAGGGGGCAGTGAGGGAAGATGG + Intronic
932425494 2:71631833-71631855 CAGTGTGCAGCGAGGGAGGAGGG - Intronic
932457797 2:71860700-71860722 GTGTGTGCAGTGAGACAGGAGGG + Intergenic
933468447 2:82687863-82687885 CTGGGGGCACTGAGGTGGGAGGG - Intergenic
933565609 2:83946847-83946869 ATGTAGGCAGTGAGAGAGAAAGG - Intergenic
933758910 2:85661318-85661340 CTGTGCGGTGAGAGGGAGGATGG + Intronic
933783860 2:85822563-85822585 ATGTGGAGAGAGAGGGAGGAAGG - Intergenic
933990251 2:87628679-87628701 CTGTGGACAGTGAGGGGAGGAGG + Intergenic
934766257 2:96881734-96881756 CAGGGGGCAGGGAGGGGGGAGGG + Intronic
934982068 2:98850824-98850846 CTGTGGTCAGTTAGGGTGGAGGG - Intronic
935104283 2:100025191-100025213 TTTTGGGGAGTGAGGAAGGAAGG - Intronic
935673779 2:105576894-105576916 CTGAGGCCAGTGAGGAAAGAAGG + Intergenic
935701092 2:105812568-105812590 CCTTGGTCAGGGAGGGAGGAGGG + Intronic
935827196 2:106963654-106963676 CTGTGGCCAGTGAGAAAGAAAGG - Intergenic
936303595 2:111322145-111322167 CTGTGGACAGTGAGGGGAGGAGG - Intergenic
936449993 2:112626768-112626790 CAGTGGGCAGTGAGGGGGCTAGG - Intergenic
937128047 2:119486863-119486885 CTGTGGGCAGCCGTGGAGGATGG + Intronic
937294253 2:120800124-120800146 GTGTGGACAGTGGGTGAGGAGGG + Intronic
937639766 2:124198559-124198581 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
937983663 2:127629023-127629045 CTGTGGGCTATGGGGGAGCATGG + Intronic
937985587 2:127636771-127636793 CTGGGGGCAGAGAGGGTGGGTGG - Intronic
938159665 2:128973856-128973878 CTGGTGGCAGGCAGGGAGGAGGG - Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938554137 2:132408595-132408617 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
938951529 2:136259112-136259134 ATGTGGGCAGTGAGGCAGTAAGG - Intergenic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
939529790 2:143343559-143343581 GTGTTGGCAGTGTGGGGGGATGG + Intronic
939618010 2:144381906-144381928 CTGTGGGTAGAGAGGTTGGATGG + Intergenic
940058375 2:149537553-149537575 CTGTTATCAGTGAGGTAGGATGG - Intergenic
940667406 2:156625590-156625612 ATGTGGGGAGGTAGGGAGGAAGG + Intergenic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
943387146 2:187216071-187216093 TTGTGGGCAGAGTGGGAGGAGGG + Intergenic
946392723 2:219426222-219426244 CTGTTGGCAGTGAGTGAGCCTGG + Exonic
946865141 2:224035917-224035939 ATGTGGGCAGTGCGGGAGCCTGG + Intronic
947414066 2:229875184-229875206 CTGTGGATAGTGATGAAGGATGG + Intronic
947461075 2:230305765-230305787 CTGTGGGCAGGGTGGGTGCAGGG - Intronic
947869812 2:233428311-233428333 CTGTGGGCAGCTAAGAAGGATGG + Intronic
948035590 2:234855899-234855921 GTGGGGGCAGTGAGGATGGAGGG - Intergenic
948078267 2:235183924-235183946 CTGTGGAGAGACAGGGAGGAAGG - Intergenic
948384776 2:237574705-237574727 CTCTGGACAGAGAGGAAGGAAGG - Exonic
948456777 2:238108185-238108207 CTGCGCGAAGGGAGGGAGGATGG - Intronic
948487658 2:238291099-238291121 CTGTTGGCACTGTGGGAGGCAGG + Intergenic
948540685 2:238689830-238689852 GTGTAGGAAGGGAGGGAGGAGGG + Intergenic
948547804 2:238745295-238745317 GTGTGGGCAATGATGGAGGGTGG - Intergenic
948768129 2:240233743-240233765 CTGTGGGCAGGGTCGGAGGAGGG - Intergenic
948768148 2:240233798-240233820 CTGTGGGCAGGGCCGGAGGAGGG - Intergenic
948800630 2:240431916-240431938 CACTGGGCAGTGAGGGTGGGTGG - Intergenic
949032348 2:241803056-241803078 CCGTGGGCAGAGCAGGAGGAGGG - Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168832562 20:854607-854629 CGGTGGACACTGAGGGAGGAGGG - Intronic
1169064988 20:2690122-2690144 CTGTGGGCACTGGGGTAGGGAGG + Intergenic
1169219915 20:3816168-3816190 CTGAGAACAGTGAGGCAGGAAGG - Intergenic
1169698867 20:8424151-8424173 CTGTGTGTGGTGGGGGAGGAGGG - Intronic
1170007047 20:11680768-11680790 TTGTGGGCAGATAGGGAGGGAGG + Intergenic
1170169846 20:13398387-13398409 CGGGGGGCAGTGCGGGAGCATGG + Intronic
1170436289 20:16333087-16333109 ATGTGGGCAAAGAGGTAGGAAGG - Intronic
1170683506 20:18547724-18547746 CAGTGGGGAGTGGGGGTGGAGGG - Intronic
1170705272 20:18738739-18738761 CTGCCAGCAGGGAGGGAGGAAGG + Intronic
1170937881 20:20825408-20825430 CTGTGAGCTGCGAGGGAGGCCGG + Intergenic
1171349214 20:24490127-24490149 CTGTGGGCAGTGACAGGGGCAGG + Intronic
1171388561 20:24786567-24786589 AAGGGGGCAGTGAGGGAGGAAGG - Intergenic
1172042046 20:32052587-32052609 CTGGGGGCAGCGAGGGGAGACGG + Intronic
1172461696 20:35123793-35123815 TTGTGGGCAGTTGTGGAGGATGG + Intronic
1172778298 20:37420646-37420668 CTGTGGGCAAGGAACGAGGAGGG - Intergenic
1172786025 20:37469484-37469506 CTCTGGGAAGCAAGGGAGGAGGG - Intergenic
1172843268 20:37914890-37914912 CTGGGGGCTCTGAGGAAGGAGGG - Intronic
1173155281 20:40603252-40603274 ATGAGGGAAGGGAGGGAGGAGGG + Intergenic
1173394243 20:42663277-42663299 CTGTGGGCAATTTGGGAGGGAGG + Intronic
1173497931 20:43532648-43532670 GTGTGGGCAGTGAGAAAGGAAGG - Intronic
1173502077 20:43561288-43561310 CTGAGGGCAGTCAGGAAGGAGGG + Intronic
1173614661 20:44394903-44394925 CTAAGGACAGGGAGGGAGGAAGG + Intronic
1173647066 20:44639959-44639981 CTGTGGCCAGAGAGGTGGGAGGG + Intronic
1173827865 20:46058726-46058748 CTGGGACAAGTGAGGGAGGAGGG + Intronic
1173872524 20:46350891-46350913 CTGGGGGCAGAGAAGCAGGAGGG + Intronic
1173894595 20:46541481-46541503 CCGAGAGCAGTGAGGGAGAAGGG - Exonic
1173983312 20:47241544-47241566 GTGAGGGCAGGCAGGGAGGAGGG + Intronic
1174391891 20:50222912-50222934 CTGTGGGAAGTGTGGGGCGAGGG - Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175418284 20:58815954-58815976 CTGGGGGCAGTGAGGGCTGCAGG + Intergenic
1175548859 20:59802606-59802628 CTGTGTGCAGGGAGCGTGGAAGG + Intronic
1175642920 20:60646403-60646425 CTGTGGACAGAGAGGGTGGCTGG + Intergenic
1175773533 20:61638667-61638689 ATGTGGGCAGAGAGGAAGAAAGG - Intronic
1175825925 20:61936481-61936503 CTGTGGGCAGGGGAGGCGGAGGG - Intronic
1175892498 20:62321754-62321776 GTGGGGTCAGTGGGGGAGGAAGG + Intronic
1176087251 20:63303800-63303822 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
1176367757 21:6044122-6044144 CTGTGGGCGGAGACGGGGGAGGG - Intergenic
1176792518 21:13335533-13335555 TTGTGGGGAGTAAAGGAGGATGG + Intergenic
1176861731 21:14014791-14014813 CTGTGGGCAGCGGGGGCGGGGGG - Intergenic
1176984534 21:15420785-15420807 CTCAGGTCACTGAGGGAGGATGG + Intergenic
1177991920 21:28046407-28046429 TTGTGGGGAGTAAAGGAGGATGG + Intergenic
1178732841 21:35120594-35120616 CTGCGGGCTGTGTGGGAGTAGGG + Intronic
1179057700 21:37951495-37951517 GTGGGGTCAGTGAGGGATGAGGG - Intronic
1179255589 21:39712680-39712702 GAGTGAGCAGTGAGTGAGGAGGG + Intergenic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179623354 21:42633084-42633106 TGGTGGGCAGAGATGGAGGACGG - Intergenic
1179755762 21:43494420-43494442 CTGTGGGCGGAGACGGGGGAGGG + Intergenic
1179884444 21:44307551-44307573 CAGTGAGCAGTGAGGGGGGTGGG - Intronic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180128111 21:45805539-45805561 TTGTGGGCAGTGTGGCAGAACGG + Intronic
1180185478 21:46137139-46137161 CTGTGGGCAGTGGGGGTCGGAGG - Intronic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180869909 22:19140198-19140220 CTCTGGGCAGTCAGGGTGGGTGG - Intronic
1181116119 22:20633379-20633401 AGTTGGGCAGAGAGGGAGGAGGG - Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181863501 22:25837341-25837363 GTGTGGCCAGGGAGGCAGGAGGG + Intronic
1181929485 22:26388624-26388646 CTCTGAGCAGTGAGGGAGCTGGG + Intergenic
1181967456 22:26666953-26666975 ATGTGGGGAGGGAGGGAGGGAGG + Intergenic
1182056494 22:27359524-27359546 CTGAGGGCAGTGAGAGGAGATGG + Intergenic
1182082450 22:27538899-27538921 ATGTGGACAGGGAAGGAGGAAGG - Intergenic
1182155028 22:28063526-28063548 CGGTGGGCAGTGGGGCAGGGTGG - Intronic
1182829765 22:33295546-33295568 ACGTGGGCAGAGAGGAAGGAAGG + Intronic
1183266618 22:36830487-36830509 GTGTAGGCAGGGAGAGAGGAGGG - Intergenic
1183300206 22:37055237-37055259 CCTGGAGCAGTGAGGGAGGAAGG + Intronic
1183502845 22:38191402-38191424 CTGTGGCGAGACAGGGAGGAAGG - Intronic
1183647002 22:39132745-39132767 GTGTGGGCAGTCAGGGAGGGAGG - Exonic
1183730905 22:39617837-39617859 CAGAGAGCAGGGAGGGAGGAGGG - Intronic
1183738506 22:39657139-39657161 CTGGGGGCAGTGGGGGAAGTTGG - Intronic
1183807783 22:40226805-40226827 CATTGGTCAGTGAGAGAGGAGGG + Intronic
1184153559 22:42652164-42652186 CTGGGGGCAGTGTGGAGGGAGGG + Intergenic
1184247700 22:43244139-43244161 AGGTGGGCAGTGTGAGAGGAAGG - Intronic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
1184835652 22:47019557-47019579 GGGTGTGCAGGGAGGGAGGATGG + Intronic
1184856573 22:47149677-47149699 CAGTGGCGAGTCAGGGAGGAAGG + Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
949483740 3:4518160-4518182 CTGTGCACAGTCAAGGAGGAGGG - Intronic
950100777 3:10355435-10355457 CTGAAGGAAGTGAGGGAAGATGG + Intronic
950151981 3:10694842-10694864 CTGTCAGCAGAGAGGGAGGGGGG - Intronic
950640272 3:14344091-14344113 CCAGGGGCAGGGAGGGAGGAAGG + Intergenic
950654059 3:14425709-14425731 CTCGGGGCAGGGAGGGTGGAAGG + Intronic
950882640 3:16335619-16335641 CTGTTGGAGGTGTGGGAGGAGGG + Intronic
950955072 3:17044226-17044248 TTCTGGAGAGTGAGGGAGGAAGG + Intronic
951537209 3:23751025-23751047 GTGTGGGTAGGGAGAGAGGAAGG - Intergenic
952815865 3:37447236-37447258 CTCTCTGCAGTGAGGCAGGAGGG + Intergenic
952926854 3:38326607-38326629 TTGTGGGGAGTGAGGGAGGCAGG - Intergenic
953061859 3:39434397-39434419 GTGGGGGCAGTGAGGGTGGCGGG - Intergenic
953391348 3:42535692-42535714 CTGTGTGCAGTGAGTGGGGAGGG + Intronic
953697800 3:45173279-45173301 ATGTGGCCAGTGATGGAGGCTGG + Intergenic
954293989 3:49664101-49664123 CTTTGGGCAGAGAAGCAGGAAGG + Intronic
954501346 3:51019620-51019642 CTGTTGGAGGTGAGGGTGGAAGG - Intronic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
954580631 3:51701123-51701145 CTGTGGGCAGAGCGAGAGGGAGG + Intronic
954709411 3:52497894-52497916 GTTTGGGCAGCGAGGCAGGAAGG + Intronic
954713772 3:52517215-52517237 CTGGGGGCGCTGAGAGAGGAGGG + Intronic
955395884 3:58556902-58556924 CTGCCGGCAGGGAAGGAGGAAGG + Intergenic
955527447 3:59836013-59836035 CTATGGGGAGTGAGGGAAAATGG - Intronic
956040720 3:65142328-65142350 CTGTTGGCAGTTGGGGTGGAGGG - Intergenic
956265514 3:67392157-67392179 CAGGGGTCAGTGAAGGAGGAAGG - Intronic
956615665 3:71169597-71169619 CGGGGGGCGGTGGGGGAGGAAGG - Intronic
956661364 3:71601577-71601599 CTGACTGCAATGAGGGAGGAAGG + Intergenic
958150337 3:89685062-89685084 TTATGGGCAGTGTGGGAGAAAGG + Intergenic
959182841 3:103004055-103004077 CTTTGGGAAGCGAAGGAGGAAGG - Intergenic
959291726 3:104483776-104483798 GGGAAGGCAGTGAGGGAGGAAGG + Intergenic
960031944 3:113062947-113062969 ATCAGGACAGTGAGGGAGGAGGG - Intergenic
961014072 3:123454036-123454058 CTGGGGGCAGAGGAGGAGGAGGG - Intergenic
961088377 3:124089731-124089753 GTCAGGGCAGTGAGGGAGGATGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961566058 3:127763978-127764000 CTGAGAGCCGGGAGGGAGGAGGG - Intronic
961601223 3:128063676-128063698 CTGTGGGCAGTGTGGGGTCATGG - Intronic
961653176 3:128427562-128427584 CTGTGGGCCATGAGGGAGGCTGG - Intergenic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
961783208 3:129333811-129333833 GGGTGGGGAGTCAGGGAGGACGG - Intergenic
962147446 3:132855399-132855421 CTGTAGGCTGTGTGGGAGCAGGG - Intergenic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
962938143 3:140100629-140100651 CAGTGGGCTGTGTGGGAGGCTGG - Intronic
963550097 3:146709380-146709402 GTATGGGAAGGGAGGGAGGAAGG - Intergenic
963692884 3:148526649-148526671 CTGGGGGCTGTGAGGGAAGTGGG + Intergenic
964311184 3:155394903-155394925 CTGTGGGGAGTGGGGGTCGAGGG - Intronic
964508045 3:157421112-157421134 TAGAGGGCAGTGATGGAGGAAGG + Intronic
965211649 3:165797324-165797346 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
966216018 3:177503439-177503461 CATGGGGCAGTGAGGGAGGAAGG + Intergenic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
966629012 3:182051088-182051110 GTGTGGGAAGTGAGGCAGGAAGG - Intergenic
966770600 3:183500350-183500372 GTGTGGCCAGGGAGGGAGGAAGG + Intronic
966892502 3:184417451-184417473 CGGGGGGCGGAGAGGGAGGAGGG + Intronic
967019523 3:185510302-185510324 CTGTGGACAGAGAGGGAGACAGG - Intronic
967054279 3:185815087-185815109 ATGTATGCAGTGTGGGAGGAGGG - Intronic
967196517 3:187030968-187030990 CAGTGGGCAGTGGGGAGGGATGG + Intronic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
967911176 3:194543735-194543757 CGGTGCTCAGTGGGGGAGGAGGG - Intergenic
967972996 3:195012868-195012890 AGGTGGGCAGTGGGAGAGGATGG + Intergenic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968486703 4:866405-866427 CTGTGGGCAGACGGGAAGGATGG + Exonic
968494911 4:910228-910250 CTGTGCTGAGTGAGGGAGGGTGG - Intronic
968538263 4:1148783-1148805 CTGTGGAGACTGAGGCAGGAGGG - Intergenic
968592129 4:1464570-1464592 CCGTAGGCTGTGTGGGAGGAAGG + Intergenic
968592528 4:1466134-1466156 GTGTGGGCAGTGGGGCGGGAGGG - Intergenic
968602824 4:1518404-1518426 CTGTGGCCAGTGAAGGAGGCCGG + Intergenic
968615719 4:1576972-1576994 CAGTGTGCAGTGTGGGAGGGAGG - Intergenic
968866412 4:3215474-3215496 GTGTGGGAAGTGCGGGGGGAAGG - Intronic
968905791 4:3449956-3449978 CTGTGGGGGCTGAGGGAGGGAGG + Intergenic
968926622 4:3551737-3551759 CTGTGGGCTCTGTGGGAGGTGGG + Intergenic
969022465 4:4147488-4147510 CTGTGGGCACTGGGGGGGGGGGG - Intergenic
969207226 4:5655999-5656021 CTGAGGGAAGTGGGGGAGGTAGG + Intronic
969527037 4:7709075-7709097 GGATGGGGAGTGAGGGAGGAAGG + Intronic
969643453 4:8412798-8412820 CGCAGGGCAGCGAGGGAGGATGG - Intronic
969686721 4:8679601-8679623 CTGTGGTGAGTGAGGGGTGAGGG - Intergenic
969965631 4:10992403-10992425 CAGTGGGGAATGAAGGAGGAAGG + Intergenic
970093951 4:12441511-12441533 CTGTGGGCAGGCTGGGTGGAGGG - Intergenic
970580685 4:17471579-17471601 CTCTGGGGAGTGAAGAAGGAGGG + Intronic
971457388 4:26857767-26857789 CTGTGGGCTGTGCGGGAGCGAGG + Intronic
971496769 4:27274801-27274823 CTGGGGGCAGTGGGGGTGGGGGG + Intergenic
972045226 4:34656981-34657003 CTTTGGGCAGCAAGGAAGGAAGG + Intergenic
972817061 4:42656661-42656683 CTGGGGGCAGCGCGGGGGGAAGG + Intronic
972960755 4:44448852-44448874 CCGTGGGGAGGGCGGGAGGAGGG + Intergenic
973027661 4:45293166-45293188 CTGTGGGCAGTGTTGGTGCAAGG + Intergenic
973321074 4:48810823-48810845 CAGTGGGTAGTGATTGAGGATGG + Intronic
973645923 4:52951187-52951209 CTTTGGTGAGTCAGGGAGGAAGG - Intronic
974646832 4:64705172-64705194 TTGTGGGGTGTGAGGGGGGAGGG + Intergenic
975229391 4:71913647-71913669 TTGTGTGTAGTGAGTGAGGAGGG + Intergenic
976002492 4:80388158-80388180 GTGAGGGCAGTGGTGGAGGAGGG + Intronic
976142436 4:82006478-82006500 CTGTGGTGAGTGAGAAAGGAAGG - Intronic
976178666 4:82379032-82379054 ATGTGGGGGGTGAGGGAGGGGGG - Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
977167168 4:93714086-93714108 CTGTTGGGGGTGGGGGAGGAAGG - Intronic
978072789 4:104492236-104492258 CTGTGGGGAGGGAGGGAGCGGGG - Intronic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
979304978 4:119131913-119131935 CTGTGGGCAGTTAGAGATTAGGG - Intergenic
980652672 4:135740032-135740054 CTGTCAGCAGTGTGGGAGGCGGG - Intergenic
980761451 4:137239056-137239078 CAGTGGGCTGTGTGGGAGCAGGG - Intergenic
982264152 4:153522847-153522869 CTGTGGGCAGTGATAGTGGGAGG - Intronic
982451014 4:155552385-155552407 CTGTGGGCTGTGAGGAAGCCGGG + Intergenic
982899650 4:160981838-160981860 CTGTGGGCATTGGGGGTGGAGGG + Intergenic
983216680 4:165008421-165008443 CTCAGGGCAGTGAAGCAGGAAGG - Intergenic
983551849 4:169025794-169025816 CAGTGAGCAGTGAGGGAGGACGG + Intergenic
983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG + Intergenic
984766201 4:183402383-183402405 CACTGGGCAGAGAGGGAGGGTGG - Intergenic
984850062 4:184144978-184145000 CAGAGGGCACTGAGGAAGGAAGG + Intronic
985521367 5:375390-375412 CAGTGGGGAGTGAGGGTGGTGGG + Intronic
985535597 5:464164-464186 CTGCGTGCAGTGTGGGAGGGAGG - Intronic
985968949 5:3360347-3360369 CAGTGGGTATTTAGGGAGGAAGG - Intergenic
986347490 5:6848352-6848374 CATGGAGCAGTGAGGGAGGAAGG + Intergenic
988339247 5:29948916-29948938 CATGGAGCAGTGAGGGAGGAAGG - Intergenic
988788804 5:34588505-34588527 CTTTGGGAAGTGAAGGAGGGAGG - Intergenic
988889451 5:35599016-35599038 CTGTGGCCACTGAGGGGGAAGGG - Intergenic
989271952 5:39544176-39544198 CTGAGGGCAGTCAGGGCAGAGGG - Intergenic
990181748 5:53168231-53168253 CTGTGGGAAGTGGAGAAGGAGGG + Intergenic
990182309 5:53174594-53174616 GTGTGGGAAGGGAGGGAGGGAGG - Intergenic
990982710 5:61616018-61616040 ATGTGGGCACTGAGGGAGCCGGG - Intergenic
991021812 5:61987248-61987270 CTGTGGGGATTGAGGGAGATTGG + Intergenic
991342289 5:65624618-65624640 CTGAGGGCGGTGAGGGGGTACGG + Exonic
991356996 5:65778949-65778971 CTGAGGGCAATGGGGGTGGAAGG + Intronic
992091632 5:73322838-73322860 CAGTGTGCAGTGACTGAGGAAGG + Intergenic
992496326 5:77297713-77297735 ATGTGGCTAGAGAGGGAGGAAGG - Intronic
992674518 5:79092333-79092355 TTGTGGGGATTGAGGGAGGTGGG - Intronic
992847829 5:80771565-80771587 CTCTGAGAAGTGAGGGAGGCAGG + Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
994513088 5:100733146-100733168 CATGGAGCAGTGAGGGAGGAAGG - Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
995047628 5:107669956-107669978 CTGGGGGAAGTGAGGGGGGCTGG - Intronic
996059525 5:119017753-119017775 CTTTGGGAGGTGATGGAGGAGGG + Intergenic
996711440 5:126547307-126547329 AGGTGGGCAGGGAGGGAGTAGGG + Intronic
996957156 5:129197233-129197255 CAGTGGGCAGGGAAGGTGGAGGG - Intergenic
997212458 5:132085493-132085515 CTGTGGGGAGAGAAGCAGGAAGG - Intergenic
997510709 5:134451903-134451925 CTGTGGCCAGCCAGGGAGGATGG + Intergenic
997681804 5:135761755-135761777 GTGTGGGCAGTGGAGGAGGAGGG + Intergenic
997949972 5:138234648-138234670 CTGTGGGAGGTCAGTGAGGATGG + Intergenic
998421078 5:141987166-141987188 TGGTGGTCAGTGAGGGAGGGGGG + Intronic
999127803 5:149259230-149259252 CTGGGAGCAGTGAGGGAGAGAGG - Exonic
999227893 5:150042422-150042444 TAGAGGGCAGTGAGGGGGGAAGG + Intronic
999389611 5:151180613-151180635 CTGTGGCCAGGGAGGGAGCTAGG - Intergenic
999513865 5:152280786-152280808 AAGGGGGCAGTGAGTGAGGAAGG + Intergenic
999921764 5:156329227-156329249 AACTGGGCAGTGAGGGTGGAGGG + Intronic
1000218655 5:159189898-159189920 CTGGGGGCAGGGAGGGTGGTGGG + Intronic
1000646179 5:163762963-163762985 TTGTGGAGAGAGAGGGAGGAGGG + Intergenic
1001088860 5:168722162-168722184 CTTTGGGCAGAGAGTGGGGAAGG + Intronic
1001156398 5:169276007-169276029 GTGTGGGCTGTGGGGTAGGATGG + Intronic
1001256131 5:170184780-170184802 CTGTGGTCAGTGAGGGACAGGGG - Intergenic
1001547872 5:172581646-172581668 CAGTGGGCAGTGCTGGAGGCTGG - Intergenic
1001559981 5:172662787-172662809 CTGTGGGTGGTTAGGGAGGAGGG - Intronic
1001804131 5:174568864-174568886 CGGTGGGCAGTGAGTGGAGAAGG + Intergenic
1002190738 5:177476173-177476195 CTGTGAGGAGGGAGGGAGGGAGG - Intergenic
1002466857 5:179412461-179412483 CGGTGGGGGGGGAGGGAGGAAGG - Intergenic
1002578992 5:180195853-180195875 CTGTGGGCAGGGAGGATGCACGG - Intronic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1003199711 6:3947820-3947842 ATGTAGGGAGGGAGGGAGGAGGG + Intergenic
1003242120 6:4353927-4353949 GTGAGGGCAGAGAGGGAAGAAGG - Intergenic
1003266135 6:4566221-4566243 CTGTGTGCAGTGATGGAGAGTGG + Intergenic
1003593624 6:7456114-7456136 CTTTGGGAAGTCAAGGAGGACGG - Intergenic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1003980200 6:11382097-11382119 CTGTGGCCTGTGGGAGAGGAGGG - Intronic
1004024666 6:11806853-11806875 CAGTGGTCAGGCAGGGAGGAAGG + Intronic
1004302226 6:14469033-14469055 CAGTGGGCAGAGAGCAAGGAAGG - Intergenic
1004331804 6:14728697-14728719 ATGTGGGCAGAGAAGGAGGAGGG + Intergenic
1004367161 6:15022051-15022073 TCGTGGGCGGTGATGGAGGAAGG - Intergenic
1004455531 6:15788315-15788337 CTGTGGACAGTGACGGGGGCTGG - Intergenic
1004493652 6:16142644-16142666 CTGTGGCCAGGGAAGGAGGTAGG - Intronic
1005488531 6:26324161-26324183 CTGGGGGAAGGAAGGGAGGAAGG + Intergenic
1006098491 6:31671020-31671042 CCAGGGGCAGGGAGGGAGGAAGG + Intronic
1006333927 6:33410879-33410901 CTGTTGGAGGTGAGGGAGGTGGG + Intronic
1006335123 6:33416362-33416384 CTGGGGGCAGAGACTGAGGAGGG + Exonic
1006361229 6:33588569-33588591 CTGAGGGCAGTAAGGGGAGATGG - Intergenic
1006898293 6:37484431-37484453 CAGTGGGAAGTGAGGGGTGAAGG - Intronic
1006903417 6:37517244-37517266 CTGAGGGCAGTCGGGGAGGAGGG + Intergenic
1006922546 6:37636277-37636299 CCAGGGGCAGTGAAGGAGGAGGG - Exonic
1007231017 6:40347857-40347879 CTGTGGGGAGGAGGGGAGGAGGG - Intergenic
1007235984 6:40391896-40391918 CTGTGCGCAGGGTGGGAGAAGGG - Exonic
1007290878 6:40785821-40785843 CTGGGAGCAGTGAGTGGGGATGG - Intergenic
1007697792 6:43744636-43744658 CGCTGGGGTGTGAGGGAGGAAGG + Intergenic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1008288397 6:49682761-49682783 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1008750305 6:54725139-54725161 CTGAGGCCAGTGGGGGAAGAAGG + Intergenic
1008883832 6:56410564-56410586 CTGAGCGGGGTGAGGGAGGAGGG - Intergenic
1009569277 6:65361213-65361235 AGGTGGGGAGTGGGGGAGGAAGG + Intronic
1009589114 6:65643220-65643242 CTGTGGGCTGTGTGGGAGCAGGG + Intronic
1009784576 6:68318242-68318264 AAGTGTGCAGTGTGGGAGGAAGG - Intergenic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1012276849 6:97284468-97284490 GTGTGTGCAGAGAGAGAGGAGGG - Intergenic
1012499688 6:99875078-99875100 CGGTGGGCAGAGTGGGAGGGAGG - Intergenic
1012950980 6:105517598-105517620 TTGGGGGCTGTGAGGGAGGCGGG + Intergenic
1012988867 6:105904460-105904482 CATGGAGCAGTGAGGGAGGAAGG - Intergenic
1013289080 6:108705506-108705528 GTGTGGGATGTGAGGGAAGAGGG - Intergenic
1013856654 6:114581151-114581173 CTGTGGGCTGTGTGGGAGTGGGG + Intergenic
1014069429 6:117163992-117164014 CTGTTGGCAGAGAAGGAGGCAGG - Intergenic
1014782499 6:125580685-125580707 GAGTGGGCAGTGAGGATGGAGGG + Intergenic
1015121763 6:129708168-129708190 TTGAGGGCAGGGAGGAAGGAGGG - Intronic
1016150141 6:140730412-140730434 ATGTGGGGAGTAAGGCAGGATGG + Intergenic
1016501153 6:144722297-144722319 CGGAGGGAAGTGAGGGAGCAAGG - Intronic
1016521458 6:144951341-144951363 CTGTGGATACTGAGGGATGATGG - Intergenic
1016614340 6:146029030-146029052 CTGTGGTCACTGAGGAAGGCGGG - Intronic
1017877936 6:158538934-158538956 CTGTGGTCAGAGAGAGAGGCTGG + Intronic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018058979 6:160075408-160075430 CACTGGGCAGTGAGGGTGGCAGG + Intronic
1018093323 6:160363600-160363622 CTGTGGGGAGTGGGCAAGGATGG - Intronic
1018134511 6:160766992-160767014 CTGTGAGAAGTGAGGGTTGAAGG - Intergenic
1018198974 6:161378261-161378283 CTGTGGCCAGTGGCGGAGGCTGG - Intronic
1018298273 6:162372558-162372580 GAGAGGGGAGTGAGGGAGGAGGG + Intronic
1018345405 6:162893757-162893779 CTGTGGGCAGTCAGATATGATGG + Intronic
1018419564 6:163630353-163630375 CAGTGGGCACTGAAGGAGAAAGG + Intergenic
1018788998 6:167131636-167131658 GAGTGGGCAGTGTGGGTGGAAGG - Intronic
1018859821 6:167703623-167703645 ATGTGGCCAGTGAGGAAGGCAGG + Intergenic
1019057797 6:169235743-169235765 GTATGGGCAGTGAGTGTGGATGG - Intronic
1019075869 6:169387757-169387779 CTGTAGGCAGAGAGGCAGGTAGG - Intergenic
1019117152 6:169774425-169774447 AGGTGGGCAGGTAGGGAGGAGGG + Intronic
1019219864 6:170464744-170464766 TTGTGAGCAGAGTGGGAGGAAGG - Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019928657 7:4209273-4209295 GGGAGGGCAGAGAGGGAGGAGGG + Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020363368 7:7353664-7353686 ATGTGGTCAGTCAGGGAAGAAGG + Intergenic
1020568299 7:9824697-9824719 CTGTTGGGGGTGAGGGATGAGGG - Intergenic
1021814619 7:24435241-24435263 CGGTGGTGAGTGAGGCAGGAAGG - Intergenic
1022142066 7:27501068-27501090 CTGGGGGCAGTGAGCAGGGACGG + Intergenic
1022253891 7:28636273-28636295 CTGGGGGGTGGGAGGGAGGAGGG + Intronic
1022393014 7:29959951-29959973 GTGGGGGGAGGGAGGGAGGAGGG + Intronic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1022798609 7:33753437-33753459 CAGTGGGCAAAGAGGCAGGAGGG - Intergenic
1022829503 7:34051368-34051390 GTATGGGCAGTGGGGGAGGTGGG - Intronic
1023003552 7:35838372-35838394 CTGTAGGGAGGGAGGGAGGGAGG - Intronic
1023024081 7:36035460-36035482 CCCAGGGGAGTGAGGGAGGAAGG - Intergenic
1023564967 7:41515251-41515273 ATGTGGGCAGTGAAGAAGGGGGG - Intergenic
1023741879 7:43288309-43288331 CCGGGAGCAGGGAGGGAGGAAGG + Intronic
1023843985 7:44111049-44111071 CTGTGGCCCGTGAGTGTGGAGGG + Exonic
1024575375 7:50759367-50759389 ATGTTGGCAGTGAGGTGGGATGG - Intronic
1024957037 7:54933266-54933288 CTGGTGGCAGAGAGGGAGGGAGG + Intergenic
1025079313 7:55968167-55968189 ATGGGGGCAGACAGGGAGGAGGG - Intronic
1026039961 7:66859922-66859944 TGGAGGGCAGTGAAGGAGGATGG - Intergenic
1026446832 7:70492103-70492125 CTGCAGGCAGTGAGGCAGGCAGG - Intronic
1026471087 7:70694515-70694537 ATGTGCGGAGGGAGGGAGGAGGG - Intronic
1026826052 7:73582263-73582285 CTGTGGGCAGTGGGGTAGGGAGG + Intergenic
1026883098 7:73919885-73919907 CAGTGGGGAGGGGGGGAGGAGGG - Intergenic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1026955235 7:74372634-74372656 CAGGGGCCAGCGAGGGAGGATGG + Intronic
1026955798 7:74375864-74375886 CTGTGGGGAGAGAGGGAGACAGG - Intronic
1027821778 7:83055237-83055259 CATTGGGCAGTAAGAGAGGATGG + Intronic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1029520505 7:101058387-101058409 TATGGGGCAGTGAGGGAGGACGG - Exonic
1029730406 7:102434494-102434516 CTCAGGGCAGTGAGGGCTGAGGG - Intronic
1029788406 7:102816758-102816780 ATGTGGGGAGGCAGGGAGGATGG - Intronic
1029883114 7:103837665-103837687 GAGTGGGCAGTGAGAGAGGGAGG - Intronic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1030416681 7:109252763-109252785 CAGTGGGGAGGGTGGGAGGAAGG + Intergenic
1030524309 7:110635199-110635221 CTGTGGGCACATAGGTAGGATGG - Intergenic
1030528821 7:110686716-110686738 ATGAGGGCAGTGAGGATGGAAGG - Intronic
1030652176 7:112128022-112128044 CTGTCGGGGGTGAGGGTGGAGGG + Intronic
1030688591 7:112510415-112510437 ATGAGAGTAGTGAGGGAGGAAGG + Intergenic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1032215187 7:129952364-129952386 CCGTAGGCACTGGGGGAGGAGGG + Intronic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032471030 7:132179547-132179569 CAGTGGGCAGTGCTGGAGGCTGG - Intronic
1032517466 7:132517809-132517831 CTGAGGGCAGTGAGGGAGTTGGG + Intronic
1032529334 7:132607329-132607351 TGGTGAGCAGTGAGGCAGGAGGG - Intronic
1033600634 7:142886018-142886040 CTCTAGGCAGTGAGAAAGGAGGG + Intergenic
1033641065 7:143263615-143263637 GTCTGGGGAGTGAGGGCGGAGGG + Intronic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1034282518 7:149864093-149864115 CTGGCGCCTGTGAGGGAGGAAGG - Exonic
1034960557 7:155361853-155361875 GAGAGAGCAGTGAGGGAGGACGG + Intronic
1034970952 7:155418750-155418772 CCGTGGGCAGGATGGGAGGAGGG - Intergenic
1034981954 7:155484774-155484796 CTGTAGGCAGTGAGGGCTGAAGG - Intronic
1035087031 7:156269092-156269114 CTGGGGGCAGATGGGGAGGAGGG + Intergenic
1035286899 7:157812386-157812408 ATGAGGGAGGTGAGGGAGGAGGG + Intronic
1035534739 8:382364-382386 CTGTGGGGAGTCAGGAAGAAGGG - Intergenic
1035734919 8:1881132-1881154 CTGTGGGAAGTGGGAAAGGAAGG + Intronic
1035754596 8:2022122-2022144 AGGTGGGCTGAGAGGGAGGAAGG + Intergenic
1035766189 8:2107510-2107532 CTGTGGGCTGGGCAGGAGGATGG + Intronic
1035939306 8:3878106-3878128 ATGTGGGCAGGGAAGGAGGAAGG - Intronic
1036010544 8:4717075-4717097 CTCGGGGCAGAGAGGGAAGAAGG - Intronic
1036207161 8:6813939-6813961 CTGGGGGCAGTGTGGTGGGAGGG - Intronic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1036693043 8:10956763-10956785 CTGTGGCCAGTGAGGACAGAAGG + Intronic
1036702584 8:11022961-11022983 CTGTGGCCAGGAAGGGAGGGAGG - Intronic
1036779292 8:11634657-11634679 GTGGGGGCAGTGGGAGAGGAGGG - Intergenic
1036950691 8:13136325-13136347 GAGTGGGGAGAGAGGGAGGAAGG - Intronic
1037466054 8:19161781-19161803 CTGTGGCCAGAGAGGCAGAAGGG + Intergenic
1037744149 8:21629934-21629956 CTGTGGCCACTGTGAGAGGATGG - Intergenic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037891816 8:22627654-22627676 AGGTGGGCAGGGAGAGAGGAGGG - Intronic
1038158080 8:25009668-25009690 CTGTGAGCAGAGAGGGAGATGGG - Intergenic
1038692264 8:29774177-29774199 CTGTGGGCATTGGGGGAGGGAGG - Intergenic
1038807174 8:30805110-30805132 CTGTGGGCAGTGAAGAAGAAAGG - Intronic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1039352950 8:36782297-36782319 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1039390673 8:37178791-37178813 CAGTGCTCAGTGAAGGAGGAGGG + Intergenic
1039436808 8:37565055-37565077 CGGTGGGAAATGAGGGTGGATGG - Intergenic
1039771691 8:40694201-40694223 CTGCAGGCAGTAAGGGAGGATGG + Intronic
1039772675 8:40703570-40703592 CAGAGGGCAGTGGGGGAGCAGGG + Intronic
1039803673 8:40981253-40981275 CCGTGGGCAGGGAGGAGGGATGG + Intergenic
1040547043 8:48406855-48406877 CTGAGGTCAGCGAGGGAAGATGG + Intergenic
1040640643 8:49330298-49330320 CGTGGAGCAGTGAGGGAGGAAGG - Intergenic
1040913585 8:52545500-52545522 GTGTGTGCAGGGAGGGAGGTGGG - Intronic
1041185372 8:55294652-55294674 CTGGAGACAGTGAGGGAGTAAGG - Intronic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041437437 8:57858128-57858150 CTGGGAGCAGGGAGGGAGGCAGG + Intergenic
1041444236 8:57932079-57932101 GGGGGGGCAGGGAGGGAGGAAGG + Intergenic
1042040349 8:64582131-64582153 GGGTGGGGAGGGAGGGAGGAGGG + Exonic
1042157084 8:65855948-65855970 ATGTGGGCAGTGAGGATGGTTGG - Intergenic
1042179110 8:66067180-66067202 CGGTGGGAAGTGGGGGAGGGTGG - Intronic
1042373481 8:68019423-68019445 CTGTCGGCAAGGTGGGAGGAAGG + Intronic
1042645552 8:70982492-70982514 CTGGGGGCTGTGTGGGAGCAGGG - Intergenic
1042873501 8:73419353-73419375 CTGTGAGCAGGTAGAGAGGATGG + Intergenic
1043130489 8:76454944-76454966 CTGTGCTCAGTGAGGAGGGAGGG + Intergenic
1043362410 8:79490271-79490293 CTGTGGGCAGTGGGGGAGAAAGG + Intergenic
1043510156 8:80943162-80943184 TTGTGGGATGTGAGGGAGGGAGG - Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1043960850 8:86416934-86416956 CCTTGGGCAGCAAGGGAGGAAGG - Intronic
1044698064 8:94942765-94942787 CTGAGGTCAGTAATGGAGGAAGG + Intronic
1044820671 8:96153849-96153871 CCGTGTGCAGTCTGGGAGGAAGG + Intronic
1045716576 8:105054050-105054072 ATGTGGGCCATGAGGTAGGAAGG + Intronic
1046747650 8:117893513-117893535 ATTTGGGCAGTGAGGCAAGAAGG + Intronic
1046919390 8:119712035-119712057 CATGGAGCAGTGAGGGAGGAAGG + Intergenic
1046954741 8:120051827-120051849 CTCTTGGCTGTGAGGAAGGAAGG + Intergenic
1047032168 8:120894163-120894185 TTGGGGGCAGGGAGGAAGGAGGG - Intergenic
1047471660 8:125179773-125179795 GTGGGGGCAGTGAGGATGGAGGG - Intronic
1047487420 8:125344221-125344243 CTGACGGCAATGAGGGTGGATGG - Intronic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047613753 8:126545769-126545791 TTGTGGGGAGAGGGGGAGGAGGG + Intergenic
1047832272 8:128647760-128647782 AGGTGGGCAGGGAGGGAGGCAGG - Intergenic
1047953667 8:129956816-129956838 CTGGGGGGAGGGAGGGAGGGAGG - Intronic
1047958913 8:129996717-129996739 CTGCGGGCTGTGGGGGAGGGAGG - Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048167390 8:132075628-132075650 TTGTTGGCAGTGAAGGAGGAAGG - Intronic
1048209567 8:132443547-132443569 GTGTGGGTAGTGGGGGATGATGG - Intronic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1048905457 8:139083926-139083948 CTGTGGGGAATGAGGGAATAAGG - Intergenic
1049227888 8:141466378-141466400 GAGTGGGCAGTGAGGCAAGAGGG + Intergenic
1049235104 8:141508333-141508355 CTGGGGGCAGTGAAGCCGGAGGG + Intergenic
1049417243 8:142500653-142500675 CTGAGGTCAGAGAGGGAGGGTGG + Intronic
1049541329 8:143210504-143210526 CTGTGGGCAGGGAGCGGGGGTGG + Intergenic
1049577384 8:143396009-143396031 GTGTGGGGAGTTAGGGAGGAGGG + Intergenic
1049865589 8:144933607-144933629 CTGTGGGCAGGAGGGGAGGTTGG - Intronic
1050143254 9:2538637-2538659 CTGTGGGGAGGTGGGGAGGAGGG - Intergenic
1050353421 9:4761495-4761517 CTGAGAGCAGTGTGGGAGGCTGG - Intergenic
1051243058 9:15080552-15080574 CTGTGGGCAGTGAGGCATAAAGG - Intergenic
1051556119 9:18384486-18384508 ATGAGGGCATTGAAGGAGGAAGG - Intergenic
1051605887 9:18917534-18917556 CTGTGTGCTTTGAGGGAGAAGGG - Intergenic
1052067033 9:24034660-24034682 CTATGTCCAGGGAGGGAGGAAGG + Intergenic
1052393847 9:27913738-27913760 CTGTCGGGAGGAAGGGAGGAAGG - Intergenic
1052859390 9:33427520-33427542 CTGTGGGGAGAGAGAAAGGAAGG + Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053209937 9:36219156-36219178 CTGTTGGCAGTGGGGGTAGAAGG - Intronic
1053801541 9:41767119-41767141 CTGTGGGCTCTGTGGGAGGTGGG + Intergenic
1054143658 9:61547707-61547729 CTGTGGGCTCTGTGGGAGGTGGG - Intergenic
1054189972 9:61979273-61979295 CTGTGGGCTCTGTGGGAGGTGGG + Intergenic
1054463434 9:65479042-65479064 CTGTGGGCTCTGTGGGAGGTGGG - Intergenic
1054648542 9:67609318-67609340 CTGTGGGCTCTGTGGGAGGTGGG - Intergenic
1054759713 9:68993366-68993388 CTGAAGGAAGTGAGGGAGCATGG - Intronic
1054814674 9:69463739-69463761 CTGCAGGGAGTGAGGGAAGAAGG + Intronic
1055075564 9:72211808-72211830 CTGGGGGCAGTGGGAGAAGAGGG + Intronic
1055912038 9:81364094-81364116 CTGTGGGCTATGTGGGAGCAGGG + Intergenic
1056538812 9:87553873-87553895 TTGTGGGCAGAAAGGGAGGCAGG + Intronic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1056767867 9:89455730-89455752 GTCTGGAAAGTGAGGGAGGAAGG - Intronic
1056911718 9:90707049-90707071 CAGTGTGCAGTGCAGGAGGAAGG + Intergenic
1057191371 9:93089754-93089776 CTGGGGGCAGGGAAGGAGGGAGG - Intergenic
1057250864 9:93500515-93500537 TTGTGGGGAGTGACGGGGGAAGG - Intronic
1057700397 9:97359898-97359920 CTGTGGGAAGTGCGGGAACAGGG - Intronic
1057813750 9:98278908-98278930 GTGTGGGCACTGAGGAAGGTTGG - Intergenic
1058061968 9:100507014-100507036 CAGTGGGGAGAGAGGGAGAAAGG - Intronic
1058194020 9:101952283-101952305 CTTTGGGCAGTGAAGGACGTAGG - Intergenic
1058637324 9:107049285-107049307 CAGTGGACAGTGCAGGAGGAGGG - Intergenic
1058833169 9:108837507-108837529 CTGAGGGTAGAGAGGGAGGCTGG - Intergenic
1059119201 9:111627006-111627028 CTGGGGCCTCTGAGGGAGGAGGG + Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059354037 9:113686129-113686151 CTCTGGGCGCTGAGGGTGGAGGG + Intergenic
1060056026 9:120413793-120413815 ATGGGCGCAGTGAGCGAGGAGGG + Intronic
1060110378 9:120902492-120902514 CTGTGGGCAGGGCGGGGGGTGGG + Exonic
1060193307 9:121606721-121606743 CAGTGGGGGGTGAGGGAGGTGGG + Intronic
1060424512 9:123493293-123493315 CTGTGGGCAACCAGGGAGGTTGG + Intronic
1060882930 9:127131108-127131130 CTGTGGGCTGTGGGGGTGGAGGG + Intronic
1061420817 9:130472094-130472116 CTGTGGGAGGTGGGGGAGGCAGG + Intronic
1061563448 9:131421581-131421603 CTGGGGGCAGTGAGAGAGAAAGG - Intronic
1061726966 9:132587319-132587341 GTGTCCGCAGTGAAGGAGGAGGG + Exonic
1061736682 9:132665550-132665572 CTCTGAGCAGAGAGGGAGCAAGG + Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062177796 9:135173847-135173869 CTGCGGGCTGTGAGGGAGAAGGG + Intergenic
1062285236 9:135769924-135769946 CTGCGGGCAGTGGGGGAGGCCGG - Intronic
1062437132 9:136551318-136551340 CTGGGGGTAGTGAGGGGGCATGG - Intergenic
1062438283 9:136556806-136556828 CTGTGGGCTGTGGGGGAAGAAGG - Intergenic
1062467508 9:136687647-136687669 CTGTGGGGAGGGAGCGTGGAGGG - Intergenic
1062694241 9:137865015-137865037 CTGTGGCCTGTGAGGGAAGCGGG + Intronic
1185612145 X:1399079-1399101 ATGTGGGAAGGGAGGAAGGAGGG + Intergenic
1185612158 X:1399121-1399143 ACGTGGGAAGGGAGGGAGGAGGG + Intergenic
1186137024 X:6532789-6532811 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137045 X:6532848-6532870 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137056 X:6532878-6532900 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137068 X:6532911-6532933 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137087 X:6532970-6532992 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137106 X:6533029-6533051 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137118 X:6533062-6533084 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137129 X:6533092-6533114 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137141 X:6533125-6533147 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137152 X:6533155-6533177 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137164 X:6533188-6533210 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137176 X:6533221-6533243 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137187 X:6533251-6533273 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137198 X:6533281-6533303 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137218 X:6533343-6533365 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137240 X:6533405-6533427 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137252 X:6533438-6533460 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137263 X:6533468-6533490 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137275 X:6533501-6533523 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137287 X:6533534-6533556 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186189377 X:7053815-7053837 GTGAGGGCTGTGAGTGAGGAGGG + Intronic
1186267155 X:7844205-7844227 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267177 X:7844267-7844289 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267199 X:7844329-7844351 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267211 X:7844362-7844384 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267222 X:7844392-7844414 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267234 X:7844425-7844447 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267245 X:7844455-7844477 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186297738 X:8169171-8169193 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297750 X:8169204-8169226 GTGTGGGGAGGGAGGGAGGGGGG - Intergenic
1186297764 X:8169237-8169259 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297776 X:8169270-8169292 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297788 X:8169303-8169325 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297800 X:8169336-8169358 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297812 X:8169369-8169391 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297824 X:8169402-8169424 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297836 X:8169435-8169457 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297858 X:8169497-8169519 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297870 X:8169530-8169552 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297882 X:8169563-8169585 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297904 X:8169625-8169647 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297926 X:8169687-8169709 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297940 X:8169724-8169746 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297952 X:8169757-8169779 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297964 X:8169790-8169812 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297978 X:8169827-8169849 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186324882 X:8466630-8466652 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324955 X:8466838-8466860 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324967 X:8466871-8466893 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324978 X:8466901-8466923 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324989 X:8466931-8466953 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325001 X:8466964-8466986 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325014 X:8466997-8467019 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325036 X:8467059-8467081 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325117 X:8467296-8467318 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186801090 X:13092929-13092951 CAGTGGGCAGTGAGGGGGCAGGG + Intergenic
1186852705 X:13596324-13596346 CATGGAGCAGTGAGGGAGGAAGG - Intronic
1187146195 X:16639602-16639624 CACTGGGCAGTGGGGGAAGAGGG - Intronic
1187298255 X:18023671-18023693 CTATGGGCTGTGACGGAGAAGGG - Intergenic
1187463898 X:19512168-19512190 CTGTGGGGAGTGGGAGGGGAGGG + Intronic
1187588824 X:20693363-20693385 CTGTGGGCTGCAAGGGAGCAGGG + Intergenic
1187814068 X:23211852-23211874 GTGGGTGCAGTGAGGGAGAAGGG - Intergenic
1189171647 X:38915221-38915243 CTGTGAGCTGAGAGTGAGGAGGG + Intergenic
1189251067 X:39601122-39601144 ATTTGGGCAGTGAGGAGGGAGGG - Intergenic
1189285240 X:39847514-39847536 CAGTGGGCAGTAGGGGAGGTAGG + Intergenic
1189323144 X:40098052-40098074 CTGTTGGGAGGGAGGGAGGTAGG - Intronic
1189537119 X:41946880-41946902 CTGAGGGTTGTGAGGGAGAAAGG + Intergenic
1190013383 X:46804976-46804998 CTGGGGGCAGGGAGTGAGGTGGG - Intergenic
1190014721 X:46817133-46817155 CTGTGGACAGGAAGGCAGGAAGG + Intergenic
1190060310 X:47206571-47206593 TGGTGGGAAGTGAGGGAGGGAGG - Intronic
1190339961 X:49288381-49288403 CAGTGGCCAGTGAGGAAGAAGGG - Intronic
1190341933 X:49303853-49303875 CTGTGGCCTCTGAGGGAGAAGGG + Intronic
1190491886 X:50990624-50990646 CTGAGGGCAGAGAGGGAGGCAGG - Intergenic
1190501276 X:51081056-51081078 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1191930535 X:66366731-66366753 CTGGAGGCAGTGAGGCAGTATGG - Intergenic
1192042534 X:67637978-67638000 CTGGGGCCAGTGAGGGGTGAGGG - Intronic
1192176406 X:68888641-68888663 ATGTGGTCAGAGAGGGAGGCAGG + Intergenic
1192214811 X:69150713-69150735 CCCTGGGCAGTGAGTAAGGAGGG + Intergenic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1192428860 X:71099334-71099356 ATGTCACCAGTGAGGGAGGAAGG + Intronic
1192750673 X:73987280-73987302 CTGTTGGCAGTGATGGGGAAAGG + Intergenic
1193817564 X:86122287-86122309 CTGTGGGCTGTGTGAGAGCAGGG - Intergenic
1195306154 X:103585802-103585824 CAGTGGGCAGAGGGTGAGGAAGG + Intronic
1195934620 X:110113023-110113045 CAGAGGGGAGGGAGGGAGGAAGG - Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196309651 X:114148609-114148631 CAGTGGGCTGTGAGGGATGAAGG + Intergenic
1197027585 X:121773507-121773529 AAGTGGGGAGAGAGGGAGGATGG - Intergenic
1197034675 X:121859483-121859505 CTGTGGGCTCTGTGGGAGTAGGG - Intergenic
1197120056 X:122880523-122880545 CTGTGGGCTGTGTGGGAGCAGGG + Intergenic
1197146311 X:123176390-123176412 AGGAGGGGAGTGAGGGAGGAGGG - Intergenic
1197183780 X:123563687-123563709 CTGAGGGGAGTGAGGCAGGGAGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198222258 X:134613375-134613397 CTATGGGCAGAGGCGGAGGAAGG + Intronic
1199760799 X:150902596-150902618 CAGTGGGGAGTGAGGTGGGAAGG - Intergenic
1199825837 X:151498419-151498441 GTGTGGACAGGGAGGGAGGTGGG + Intergenic
1199963745 X:152801038-152801060 GTGTGGGAAGGGAGGGAGGTGGG - Intergenic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1200862333 Y:8006290-8006312 TTGTGGGCAGTGTGGTAGGACGG + Intergenic
1201438409 Y:13984885-13984907 CTGTGGGGAGGGAGGAAGGGGGG - Intergenic
1201438446 Y:13985005-13985027 CTGTGGGGAGGGAGGAAGGGTGG - Intergenic
1201446127 Y:14057703-14057725 CTGTGGGGAGGGAGGAAGGGTGG + Intergenic
1201446164 Y:14057823-14057845 CTGTGGGGAGGGAGGAAGGGGGG + Intergenic