ID: 1181135615

View in Genome Browser
Species Human (GRCh38)
Location 22:20763952-20763974
Sequence CTATTTTACTAGAGGGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181135608_1181135615 28 Left 1181135608 22:20763901-20763923 CCATGCAACCAAAGCACTCTGCC 0: 1
1: 0
2: 1
3: 11
4: 127
Right 1181135615 22:20763952-20763974 CTATTTTACTAGAGGGTTGGTGG 0: 1
1: 0
2: 1
3: 11
4: 151
1181135609_1181135615 20 Left 1181135609 22:20763909-20763931 CCAAAGCACTCTGCCTTTCTTTT 0: 1
1: 0
2: 8
3: 60
4: 677
Right 1181135615 22:20763952-20763974 CTATTTTACTAGAGGGTTGGTGG 0: 1
1: 0
2: 1
3: 11
4: 151
1181135607_1181135615 29 Left 1181135607 22:20763900-20763922 CCCATGCAACCAAAGCACTCTGC No data
Right 1181135615 22:20763952-20763974 CTATTTTACTAGAGGGTTGGTGG 0: 1
1: 0
2: 1
3: 11
4: 151
1181135610_1181135615 7 Left 1181135610 22:20763922-20763944 CCTTTCTTTTATGTATTGAGCTT 0: 1
1: 0
2: 1
3: 32
4: 417
Right 1181135615 22:20763952-20763974 CTATTTTACTAGAGGGTTGGTGG 0: 1
1: 0
2: 1
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181135615 Original CRISPR CTATTTTACTAGAGGGTTGG TGG Intronic
901196789 1:7444789-7444811 CTTTGTTTTTAGAGGGTTGGGGG - Intronic
904157518 1:28497005-28497027 CTCTTTTATCAGAAGGTTGGGGG - Exonic
907041619 1:51266015-51266037 CTATCTTAATAAAGGGTTGGAGG - Intronic
909693132 1:78433079-78433101 CTATTTTACTATGGTGTTAGTGG + Intronic
911993559 1:104734012-104734034 AAATATTACTAGAGTGTTGGAGG - Intergenic
912428182 1:109612686-109612708 CTACTTTCCTGAAGGGTTGGTGG - Exonic
915045372 1:153009020-153009042 CTATTTTTCAAGAAGGTGGGTGG + Intergenic
915320646 1:155054302-155054324 CTTTTTTCTTAGAGGCTTGGTGG + Exonic
916506903 1:165436324-165436346 CTATTTTACCAAAGGGTGGGAGG - Intronic
917587459 1:176442192-176442214 TTATTCTACTGGAGGGCTGGTGG + Intergenic
920802682 1:209204199-209204221 ATATTTTATTATAGGGCTGGAGG + Intergenic
921825740 1:219670064-219670086 ATATTTTACTAAGAGGTTGGTGG - Intergenic
921950572 1:220925971-220925993 GCATTTTCCTAGAGGGCTGGAGG + Intergenic
924028870 1:239866882-239866904 CTATTTTATCAGATGGTTGTTGG - Intronic
1064348485 10:14554779-14554801 CTTTTTTGGTAGAGGATTGGAGG - Intronic
1064368323 10:14728257-14728279 CTATTTTTCAAGAGAGTTGATGG - Intronic
1064690803 10:17916772-17916794 CTATATTACTAAAAGGTTGAAGG - Intergenic
1064736429 10:18386250-18386272 CTATTTTTCTAGTGGGTTGTTGG + Intronic
1064825317 10:19392219-19392241 TTATTTTACTAAAGGGGTAGAGG + Intronic
1065286003 10:24188311-24188333 CACTTTTACTTGAGGTTTGGAGG - Intronic
1067800111 10:49352956-49352978 CTTTTTTACTGCAGGGTTGTAGG - Intergenic
1067995731 10:51271183-51271205 ATATATGACTAGATGGTTGGGGG + Intronic
1070332266 10:75426654-75426676 GTATTTTAATTGAGGGTGGGAGG + Intergenic
1074505208 10:114063652-114063674 CTATTTTCCTAGGTGCTTGGTGG - Intergenic
1075781454 10:125020137-125020159 CTATTTTCCTGGAAGGTTTGCGG - Intronic
1075837293 10:125465532-125465554 CAATTTTACTAGGGAGTTGCTGG + Intergenic
1077780454 11:5323208-5323230 GTACTTTACCATAGGGTTGGGGG - Intronic
1078606041 11:12776400-12776422 GTTTATTCCTAGAGGGTTGGGGG + Intronic
1078710826 11:13789337-13789359 CTAGTTTAAGAGAGGCTTGGTGG - Intergenic
1079894655 11:26103101-26103123 CAATATTTCTAGTGGGTTGGGGG + Intergenic
1080388109 11:31822014-31822036 CTTTTTTATTAAAGGGTTGCAGG - Intronic
1080790842 11:35521170-35521192 ACATTTTACTAAAGAGTTGGAGG + Intronic
1083134857 11:60662731-60662753 TTTTTTTACTCGAGGATTGGTGG + Intergenic
1083497504 11:63070263-63070285 GTGTATTACTAGAGGGTTGGCGG + Intergenic
1085225556 11:74917523-74917545 CTATTTCACTAGAGGATTCTGGG - Intronic
1088039792 11:105365640-105365662 CTATATTACTACAGGTTTTGTGG + Intergenic
1088139225 11:106595554-106595576 CTTTTTTTGTAGAGGGGTGGGGG + Intergenic
1088638699 11:111850037-111850059 GTATTTTACTAGATGTTTTGAGG - Intronic
1091206087 11:133822172-133822194 CTATTTCTCTAGATGGTGGGAGG - Intergenic
1092696267 12:11175176-11175198 TTATTTTATTAGAGGGTTGGTGG + Intergenic
1092845592 12:12581954-12581976 CTAATTTTCTAGTGGGTAGGAGG + Intergenic
1093446679 12:19267661-19267683 CTATTTTTTTGGGGGGTTGGGGG - Intronic
1094452677 12:30598959-30598981 CTTTTTTAGAAGAGGGTTGTAGG + Intergenic
1096759634 12:53829912-53829934 CTATATTACTAAAGGTATGGAGG + Intergenic
1097167303 12:57092755-57092777 CTATTGTTGTAGGGGGTTGGGGG - Intronic
1097368888 12:58751106-58751128 TTATTGTACTAAAGGTTTGGAGG + Intronic
1098961914 12:76747688-76747710 ATATTATACAAGAGTGTTGGAGG - Intergenic
1101452922 12:104796829-104796851 TTATTTTACTATTGGGTTGCTGG + Intergenic
1103187914 12:118977461-118977483 CTATTTTAATAAAGTGATGGAGG + Intergenic
1103313297 12:120029974-120029996 CTATTTTAAAAGAAGGTTGATGG - Intronic
1106151271 13:27105187-27105209 CTATTTTAAAAAGGGGTTGGGGG + Intronic
1110255229 13:73426124-73426146 CTATTTAAAAAGAAGGTTGGGGG - Intergenic
1111908503 13:94283561-94283583 CTGTGTTAGTACAGGGTTGGTGG - Intronic
1115984630 14:39091215-39091237 GTATTTTACTAGAGATTTGAAGG - Intronic
1116355257 14:43920423-43920445 CAATTTTACTAGATTTTTGGTGG - Intergenic
1118815468 14:69310474-69310496 CTGTTTAACTACAGGGTGGGTGG + Intronic
1121679098 14:95777655-95777677 CTGTTATACTAGAGGCTTGCTGG - Intergenic
1129503931 15:76065308-76065330 CTGTTTCAGTAGAGGGGTGGGGG - Intronic
1130614772 15:85394626-85394648 CCATTTTACCAGGGGGTGGGAGG - Intronic
1135075370 16:19388867-19388889 TTTTTTTTCTAGAGGGTAGGGGG + Intergenic
1136273915 16:29166701-29166723 CGATTGTATTTGAGGGTTGGAGG - Intergenic
1137628000 16:49921699-49921721 ACATTTAACTAGGGGGTTGGAGG - Intergenic
1138042896 16:53693637-53693659 TTATTTTACTAGAGTGTTTGTGG - Intronic
1142077458 16:88128444-88128466 CGATTGTATTTGAGGGTTGGAGG - Intergenic
1146861191 17:36300628-36300650 CTGTTTTACTAGATGGATGTTGG - Intronic
1146963337 17:37003775-37003797 CTCTTTTAGTAGAGTGGTGGAGG + Intronic
1147091522 17:38104732-38104754 CTGTTTTACTAGATGGATGTTGG - Intergenic
1147105690 17:38215773-38215795 CTGTTTTACTAGATGGATGTTGG + Intergenic
1147267119 17:39241329-39241351 GTATTTTAGTAGAGAGATGGGGG + Intergenic
1149179092 17:53912706-53912728 CACTTTGACTAGAGGGATGGGGG - Intergenic
1150168990 17:62971902-62971924 CAATTTTTCCAGAGGGTAGGGGG - Intergenic
1151018361 17:70583893-70583915 CTATTTAATTAGAGTTTTGGAGG + Intergenic
1153430528 18:5011482-5011504 CTTTTTTCCTATAGAGTTGGTGG - Intergenic
1156950122 18:42885660-42885682 CTATTAGAGGAGAGGGTTGGTGG + Intronic
1161665557 19:5574065-5574087 CTATTTGCCTACAGGATTGGTGG + Intergenic
1168461739 19:56565446-56565468 CTATTTTTCTAGTGGGCTTGAGG + Intergenic
926310141 2:11669341-11669363 CCATTTTACTAGAAGGAGGGAGG - Intronic
927120906 2:19961885-19961907 CAATTTTGCTAGAGTTTTGGCGG + Intronic
929904254 2:46032412-46032434 CCATTTTAAGAGAGGGATGGCGG - Intronic
930205494 2:48583594-48583616 CTATTTTAGTTGAGGGTTGTTGG + Intronic
933014274 2:77104515-77104537 CTATTTTGTATGAGGGTTGGAGG - Intronic
933025874 2:77258148-77258170 TTATTTTACTAGATGTGTGGTGG - Intronic
935769861 2:106407889-106407911 CTATTTTCCTATTGGGTTGCTGG + Intronic
935910232 2:107888034-107888056 CTATTTTCCTATTGGGTTGCTGG - Intronic
935968351 2:108504884-108504906 CTATTTTCCTATTGGGTTGCTGG - Intronic
936132022 2:109853172-109853194 CTATTTTCCTATTGGGTTGCTGG - Intronic
936212675 2:110518313-110518335 CTATTTTCCTATTGGGTTGCTGG + Intronic
936421813 2:112372893-112372915 CTATTTTCCTATTGGGTTGCTGG + Intronic
936493614 2:112997760-112997782 CAATTTTACCAATGGGTTGGAGG + Intergenic
941191168 2:162384299-162384321 CTATAATATTATAGGGTTGGGGG + Intronic
942173121 2:173306563-173306585 CCATTTTGCTAGAGGCCTGGAGG + Intergenic
943501463 2:188694106-188694128 CTATTTCACTGGAGGCATGGGGG + Intergenic
947084373 2:226434678-226434700 CAACCTTTCTAGAGGGTTGGAGG + Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1171996417 20:31735250-31735272 TTTTTTTAGTGGAGGGTTGGGGG + Intergenic
1175734050 20:61373049-61373071 CTAATTTTCTAGACAGTTGGAGG + Intronic
1178595276 21:33947832-33947854 ACATTTTACAATAGGGTTGGGGG - Intergenic
1180859437 22:19068936-19068958 CTTTTTCACAAGGGGGTTGGAGG - Intronic
1181135615 22:20763952-20763974 CTATTTTACTAGAGGGTTGGTGG + Intronic
1182761199 22:32723678-32723700 CTATTTTCATAAAGGGGTGGAGG - Intronic
1184614351 22:45627904-45627926 CCATTTCATTAGAGGTTTGGGGG - Intergenic
950123166 3:10495237-10495259 CCTTTTTCCTGGAGGGTTGGGGG + Intronic
951296382 3:20940863-20940885 CTCTTTTACTAGAGGTTTGTTGG + Intergenic
953069670 3:39506565-39506587 TTATCTTACCAGAGGGGTGGAGG + Intronic
955238161 3:57157839-57157861 CTGTTTTACTCGAGAGTGGGAGG - Intronic
960189102 3:114681614-114681636 GTATTTTAATAGAGGGTTTATGG + Intronic
963451803 3:145491184-145491206 CTAGTTGCCTAGAAGGTTGGAGG - Intergenic
963803940 3:149704199-149704221 TTAATTTAATAGAGGTTTGGGGG - Intronic
965357120 3:167689658-167689680 CTATTTTAAAAGGGGGTGGGGGG + Intronic
966168582 3:177050814-177050836 CTTTTTTTTTAGAGGGGTGGGGG + Intronic
968888611 4:3353185-3353207 CTACTTTGCTGGAGGGTGGGAGG + Intronic
971345789 4:25810612-25810634 CCATTTTCCTAGAGAATTGGAGG + Intronic
973283718 4:48391188-48391210 ATATTGTACCACAGGGTTGGAGG + Intronic
974433323 4:61826756-61826778 AAATTTTATTACAGGGTTGGGGG + Intronic
976055559 4:81061527-81061549 CTATTTTGCAAGACAGTTGGAGG + Intergenic
979699524 4:123652198-123652220 CTATTTTACAGGAAGTTTGGAGG + Intergenic
980710672 4:136562824-136562846 ATATTCTAATAGTGGGTTGGAGG + Intergenic
983795300 4:171854636-171854658 CTATTTTTCTAGAGGCTGGGAGG + Intronic
985580155 5:692049-692071 CTGTTTTGATAGGGGGTTGGGGG - Intronic
985580200 5:692208-692230 CTGTTTTGATAGGGGGTTGGGGG - Intronic
985580240 5:692366-692388 CTGTTTTGATAGGGGGTTGGAGG - Intronic
985580254 5:692419-692441 CTATTTTGATACGGGGTTGGGGG - Intronic
992270544 5:75058592-75058614 CTACAGTAATAGAGGGTTGGTGG + Intergenic
992348748 5:75907818-75907840 CTAATTTAATAGAGGCTTGAAGG + Intergenic
994310492 5:98263727-98263749 ATATGTTACTGGAGTGTTGGTGG - Intergenic
997084035 5:130775198-130775220 CTTTTTTTCCAGAGGGTTGAGGG + Intergenic
997831141 5:137151104-137151126 CTATTTTACCAGATGGTAGTAGG + Intronic
998169405 5:139863811-139863833 CTATCTTAATAGAGTGTGGGAGG - Intronic
1003333085 6:5145782-5145804 CAATATTACTAGAGCATTGGTGG - Intronic
1011125593 6:84003794-84003816 ATATTTCACTGGAGGCTTGGTGG + Intergenic
1011737745 6:90329613-90329635 CAGATTTACTAGGGGGTTGGGGG - Intergenic
1012589741 6:100966813-100966835 CTAGTTTACTAGATGATTGTGGG - Intergenic
1012701720 6:102466055-102466077 CCATTTTACTAGAGTGTTGAGGG - Intergenic
1014242646 6:119034825-119034847 CTAGTTTAGCATAGGGTTGGGGG - Intronic
1016611013 6:145989611-145989633 CTATTTTACCAAAGGGTTATTGG - Intergenic
1016772532 6:147868018-147868040 TTATGTTGCAAGAGGGTTGGAGG + Intergenic
1018777984 6:167035901-167035923 CTATTTTGCAAGAGAGATGGTGG + Intronic
1020807333 7:12806834-12806856 CTATTTTTCTAGTGGGTTGATGG + Intergenic
1021297635 7:18928105-18928127 CTATTTTACTACAGGGAGGCAGG + Intronic
1022147119 7:27555564-27555586 CTATTTGAGGAGAGGGTAGGGGG - Intronic
1022896245 7:34752624-34752646 GAATTTTACTAGATGTTTGGGGG + Intronic
1028763594 7:94524014-94524036 CGATTTTACTAGATGGTGTGAGG - Intronic
1029325745 7:99807475-99807497 CTATTTTGCGAGAGGTATGGAGG + Intergenic
1029620450 7:101687098-101687120 CTGTGTGACTAGGGGGTTGGAGG - Intergenic
1031655034 7:124344230-124344252 GTATTTTTCTAGATGCTTGGTGG + Intergenic
1032709281 7:134448193-134448215 CTCTTTTTCCAAAGGGTTGGGGG - Intronic
1032774349 7:135095168-135095190 CTGTCTCACTGGAGGGTTGGAGG + Intronic
1033658832 7:143390312-143390334 CTATTTTATTAGGGTGGTGGTGG + Intronic
1044884204 8:96759280-96759302 CTTCTTTACTGGAGGTTTGGGGG - Intronic
1048498818 8:134957655-134957677 CTTTTTTCCTACTGGGTTGGGGG - Intergenic
1052868505 9:33481385-33481407 CAATTTTTTTACAGGGTTGGGGG - Intergenic
1056791728 9:89629931-89629953 CTAAACTACTAGATGGTTGGTGG - Intergenic
1058041596 9:100308430-100308452 CTATTTTATTATTTGGTTGGGGG + Intronic
1186169054 X:6858033-6858055 CTATGTGATTGGAGGGTTGGGGG + Intergenic
1186637156 X:11418943-11418965 CTATTTTTGTTGAGGGCTGGCGG - Intronic
1188291543 X:28395099-28395121 CTATTTTGCTAAAGGTTTGGGGG - Intergenic
1188533304 X:31166279-31166301 CTGTTTTTCTAGGGGGTTGTAGG + Intronic
1194474154 X:94336844-94336866 CTTTTTTACTTCAGGGTTGCAGG + Intergenic
1194766144 X:97846721-97846743 CTACTTTACCAGAGGATTGAGGG - Intergenic
1195234207 X:102880768-102880790 CTATCTAAATAGAGGGTTTGGGG + Intergenic
1195918618 X:109960070-109960092 CTATTTGACAAGAGATTTGGTGG - Intergenic
1195996543 X:110737411-110737433 CACTTTGAGTAGAGGGTTGGTGG - Intronic
1197831927 X:130652124-130652146 CTATTTTAGTAGAGTGATAGAGG - Intronic
1199414075 X:147559529-147559551 CTCTTTCACTACAGGGTTTGTGG - Intergenic