ID: 1181137213

View in Genome Browser
Species Human (GRCh38)
Location 22:20776630-20776652
Sequence CTGGTACTCCAGAGCGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181137210_1181137213 -3 Left 1181137210 22:20776610-20776632 CCAGGGAGTCTGGAAGCATCCTG 0: 1
1: 0
2: 4
3: 39
4: 409
Right 1181137213 22:20776630-20776652 CTGGTACTCCAGAGCGAACAAGG 0: 1
1: 0
2: 0
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181137213 Original CRISPR CTGGTACTCCAGAGCGAACA AGG Intronic
903548788 1:24143247-24143269 CTGGAATTCCAGAGCACACAGGG - Intergenic
903583316 1:24388642-24388664 CCGTTGCTCCAGATCGAACATGG - Intronic
918396745 1:184121203-184121225 CTGGTCCTCCAGAGAGAAGTAGG + Intergenic
922609013 1:226910728-226910750 CAGGTGCTCAAGAGCGAAGATGG - Exonic
924270692 1:242329468-242329490 CTGGTACTGCATAGTGGACAAGG - Intronic
1066442569 10:35452121-35452143 CTGGTACTCAACAGCAAAAAAGG - Intronic
1068699346 10:60003318-60003340 CTGGTACTCCAGAAAGCACCTGG - Intergenic
1070520693 10:77250531-77250553 CTGGTGCTCCAGAGTGAGCCTGG - Intronic
1075010625 10:118866770-118866792 CTGGAACTCTAGAGCTGACAAGG + Intergenic
1087981391 11:104618342-104618364 CTGGAACTGCAGAGCAAGCATGG + Intergenic
1090188332 11:124752254-124752276 CTGGTATCTCAGAGCAAACAGGG + Intergenic
1091696866 12:2633509-2633531 CCGGAACTCCAGAGGCAACACGG + Intronic
1096803022 12:54123958-54123980 CTGGGAATCCAGGGCGAAGAAGG + Intergenic
1097173036 12:57128180-57128202 CTGGTGCTCCAGAGAGCAGAAGG - Intronic
1098156575 12:67605685-67605707 ATGGCACTCCAGAGCACACAGGG + Intergenic
1102694373 12:114786724-114786746 CTGGCATTCCACAGGGAACAAGG + Intergenic
1106695758 13:32170946-32170968 CTGGTCTTCTAGAGCTAACAAGG - Intronic
1107549497 13:41461773-41461795 CTGGTTCTCCAGGGCCCACAAGG - Intronic
1110177526 13:72574594-72574616 CTGGTACTCCACAGATATCATGG - Intergenic
1112088240 13:96053661-96053683 CTGGCTCTCCAGACCGAACTAGG + Intergenic
1115995006 14:39187130-39187152 CTGGTGCTCCAGAGTGAAATAGG + Intergenic
1116044185 14:39722784-39722806 CTGGTACTGCAGAGAATACAGGG - Intergenic
1117413066 14:55468174-55468196 CTGGCACTCCAGAGGGCACAAGG + Intergenic
1123166131 14:106326769-106326791 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1123168826 14:106351804-106351826 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1126782617 15:52151333-52151355 CAGGGACTCCAGAGCACACATGG - Intronic
1129627824 15:77222725-77222747 CTGGAACTCCAGAGAAAGCATGG + Intronic
1132503593 16:296131-296153 CTGGGGCTCCCGAGGGAACAGGG - Intronic
1133328970 16:4959305-4959327 TTGGTGCTCCAGCGTGAACATGG + Exonic
1133997088 16:10756673-10756695 CACGTACTGCAGAGGGAACAGGG - Exonic
1138706778 16:58923193-58923215 CTGGCACTCAAGAGAGAAGATGG - Intergenic
1141451308 16:84105287-84105309 CAGGTACTACAGAACAAACACGG + Intronic
1143329289 17:6121715-6121737 GTGGGACCCCAGAGAGAACAGGG - Exonic
1144249718 17:13403497-13403519 CTGGTACCCCAGAGAGTAAATGG + Intergenic
1148877966 17:50703637-50703659 CTGGTATTCCAGAGAAAGCAAGG + Intronic
1154955186 18:21247005-21247027 CTGGAACTCCAGAACTCACAAGG - Intronic
1157863342 18:51160875-51160897 CTGGAATTCCAGTGCCAACACGG - Intergenic
925789593 2:7470539-7470561 TTGGTATTCCAGGGGGAACAGGG - Intergenic
926108401 2:10166695-10166717 CTGGTGCGCCATAGGGAACAGGG - Intronic
926158152 2:10469464-10469486 CTGGTGCTCCAGAGTGCACAAGG - Intergenic
927715913 2:25352734-25352756 CTGCTTCTCCAGAGGGAAGAGGG + Intergenic
927954405 2:27198625-27198647 GTGGTACTCCAGGGAGAACTGGG - Intergenic
932560618 2:72864718-72864740 CTGGTTCTCCAGAGCCACCCTGG + Intergenic
932656677 2:73616623-73616645 CTGGGACTCCAGTGATAACAGGG - Intergenic
932789107 2:74637932-74637954 CTGGGACTTCAGAGAGACCAAGG - Intronic
934945103 2:98535051-98535073 CTGGATCTCCAGAGAGAAAAAGG + Intronic
936089578 2:109492346-109492368 CTGGGGCTCCAGAGTGGACAGGG + Intronic
940283823 2:152013886-152013908 CTAGGTCTCCAGAGCCAACACGG + Intronic
943723672 2:191231121-191231143 TTGGTACTGCAGAGAGCACAAGG - Intergenic
948642682 2:239385519-239385541 CTGAGACTTCAGAGGGAACAGGG - Intronic
1171063215 20:21986890-21986912 CAGAGACTCCAGAGAGAACACGG + Intergenic
1171854732 20:30333760-30333782 CTGGGAATCCAGGGCGAAGAAGG + Intergenic
1172111326 20:32546964-32546986 CTGGTCCTCCAGAGGGACCTTGG + Intronic
1172645396 20:36465946-36465968 CTGGGACTCCAGAGCCAGCAAGG - Intronic
1175344665 20:58264144-58264166 CTGGTACAACAGAACGCACAGGG + Intergenic
1175344970 20:58266284-58266306 CTGGAGCTCAAGAGCTAACACGG + Intergenic
1175841305 20:62029437-62029459 CTGGTGCTGCAGAGCTAGCAGGG - Intronic
1177519485 21:22200405-22200427 CTGCTACTCCAGAAGGCACATGG - Intergenic
1178818738 21:35955526-35955548 CTGAAACTCCAGAGGGAAGAGGG + Intronic
1181137213 22:20776630-20776652 CTGGTACTCCAGAGCGAACAAGG + Intronic
1184274233 22:43401057-43401079 CTGCTTCTCTAGAACGAACATGG - Intergenic
1184437438 22:44487972-44487994 CTGGTCCTCCAGGGCACACAGGG + Intergenic
950546329 3:13640187-13640209 CTGGTACTCCAGTGCCAGCCAGG + Intergenic
956865787 3:73367276-73367298 CTGTTACTGCAGAGCAAACAAGG + Intergenic
969966033 4:10996472-10996494 CTGGTACTGCAGAGAGAGCTGGG + Intergenic
977042871 4:92036471-92036493 CTGGTACCCCAAAGCCAAAAAGG + Intergenic
977915369 4:102586454-102586476 CTGGAACTCAAGAGAGGACAGGG + Intronic
978854313 4:113375948-113375970 CTAATACTCCAGAGCGAAGATGG - Intronic
979755607 4:124336995-124337017 CTGGTACTGCAGACTCAACAAGG + Intergenic
985885617 5:2675437-2675459 CTGATACTCTGGAGGGAACATGG - Intergenic
986510953 5:8505668-8505690 CTGGTAGGCCTGAGCTAACAGGG - Intergenic
998167439 5:139852198-139852220 CTGGTGCTCCCGAGGGAAGAAGG + Intronic
998916569 5:147018750-147018772 CTGGTAGTCCAAAGCCAGCATGG - Intronic
1002013038 5:176299458-176299480 CTGGTAATCCAAAGAGAGCAAGG + Intronic
1002073841 5:176696574-176696596 GGGGGACTCCAGAGGGAACAAGG + Intergenic
1003158885 6:3618796-3618818 CTGGTACTCCAGGCTAAACAGGG + Intergenic
1004253597 6:14042922-14042944 CTGCTACTAGAGAGTGAACAGGG - Intergenic
1004599513 6:17134070-17134092 CTGGTATTCCTGAGAGAAAAAGG + Intergenic
1007296098 6:40821969-40821991 CTGGAACTCCAGAGACACCAAGG + Intergenic
1014032854 6:116726601-116726623 GAGGTACTCCAGAGCAAATAAGG + Exonic
1016729041 6:147407730-147407752 CTGGTTCCCCAGAGCCCACAAGG + Intergenic
1019266545 7:120356-120378 CAGGCACTCCAGAGTGAACCAGG - Intergenic
1019506632 7:1394741-1394763 CTGGTACTCCACAGACAGCAAGG + Intergenic
1020255111 7:6498459-6498481 CTGGCCCTGCAGAGAGAACAGGG - Intronic
1028145637 7:87317323-87317345 CTTGTACTTCAGAGAGCACAAGG - Intergenic
1033560541 7:142526554-142526576 CTGGTGCTACAGAGCTAAGATGG + Intergenic
1035742526 8:1939021-1939043 CTGGTATTCCAGAGTGTTCAGGG - Intronic
1038277018 8:26129973-26129995 CTGCCACTCCAGAGAGCACAGGG + Intergenic
1038688082 8:29737041-29737063 CTGGCATTCCAGAGCAAACCAGG + Intergenic
1040023605 8:42762080-42762102 CTGGTGCTCCAGAGCCAAGCTGG + Intronic
1041195923 8:55401295-55401317 CTGGTATCCCAGAGCACACAAGG + Intronic
1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG + Intronic
1053792556 9:41697041-41697063 CTGGGAATCCAGGGCGAAGAAGG + Intergenic
1054152618 9:61617779-61617801 CTGGGAATCCAGGGCGAAGAAGG - Intergenic
1054180969 9:61909062-61909084 CTGGGAATCCAGGGCGAAGAAGG + Intergenic
1054656622 9:67672080-67672102 CTGGGAATCCAGGGCGAAGAAGG - Intergenic
1055686993 9:78786010-78786032 CTGGGAGTCCAGAATGAACAAGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1186118231 X:6327782-6327804 CTGGTAGTTTAGAGAGAACAAGG + Intergenic
1189396117 X:40624352-40624374 TTGGATGTCCAGAGCGAACAGGG + Intergenic
1192539459 X:71955890-71955912 GTGGTACTCCAGGGCGAGCCAGG - Intergenic