ID: 1181139623

View in Genome Browser
Species Human (GRCh38)
Location 22:20794911-20794933
Sequence CAGTTACAACAGAAGCTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 1, 2: 3, 3: 31, 4: 283}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181139621_1181139623 21 Left 1181139621 22:20794867-20794889 CCTGTTCGTTCATAGACAGGTGA 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1181139623 22:20794911-20794933 CAGTTACAACAGAAGCTGTATGG 0: 1
1: 1
2: 3
3: 31
4: 283
1181139622_1181139623 -2 Left 1181139622 22:20794890-20794912 CCACAGAAGAGTTGAGTTGAGCA 0: 1
1: 0
2: 2
3: 16
4: 140
Right 1181139623 22:20794911-20794933 CAGTTACAACAGAAGCTGTATGG 0: 1
1: 1
2: 3
3: 31
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181139623 Original CRISPR CAGTTACAACAGAAGCTGTA TGG Intronic
901248285 1:7751149-7751171 CAGTAACAACAGGGGCTGCACGG - Intronic
901330873 1:8407520-8407542 CACTTGCAACAGAAGCTCTGTGG + Intronic
901425541 1:9180557-9180579 CAGTTACAAGGGCAGGTGTAGGG + Intergenic
903076628 1:20773910-20773932 CAATTACAACAGATGCAATATGG + Intronic
903343018 1:22666352-22666374 TACTTGCAACAGATGCTGTATGG - Intergenic
907065013 1:51472524-51472546 CAGTTATAACAGAGGAAGTAGGG + Intronic
907834364 1:58095000-58095022 CAGTTGCAATAGAGACTGTAAGG - Intronic
908046399 1:60174327-60174349 CAATTACATCAGAAGCTCTATGG + Intergenic
908689160 1:66757936-66757958 TAGTTACAATAGAAACCGTAGGG + Intronic
909694421 1:78450056-78450078 CAGGTGCAACAGAAGCAGCATGG - Intronic
911491156 1:98567882-98567904 GAGTTGCAACAGAAAATGTATGG + Intergenic
911779968 1:101864102-101864124 CAGTAACAACTGAAGTTGTTAGG - Intronic
912185975 1:107276152-107276174 GATTCAGAACAGAAGCTGTAAGG - Intronic
912256766 1:108067602-108067624 CAGTCACAACAGAAGCTCTCTGG + Intergenic
913720825 1:121592624-121592646 CAGTCACAAAAAAATCTGTATGG + Intergenic
915527375 1:156484327-156484349 TAGTTACAACAGAGACTGTATGG - Intronic
916877463 1:168984821-168984843 TAGTTGCAACAGAAACCGTATGG - Intergenic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
919104820 1:193136140-193136162 TAGTTGCAACATAAACTGTATGG - Intronic
920458789 1:206121242-206121264 CAATGGCAACAGAAACTGTAAGG - Intergenic
921829753 1:219713932-219713954 CAGTTACAGCAGAACCTTTTAGG - Intronic
924451153 1:244180293-244180315 TAGTGGCCACAGAAGCTGTATGG + Intergenic
924496713 1:244597222-244597244 GAGTGACCACAGAAGCTGAAGGG - Intronic
1063549094 10:7012103-7012125 CAGTTGAAGCAGAGGCTGTATGG - Intergenic
1063576540 10:7266656-7266678 CAGTTTCAACAGAAGCCCTCTGG + Intronic
1064480152 10:15732295-15732317 CAGTCACTACAGAAATTGTAAGG - Intergenic
1065616695 10:27534555-27534577 TAGTTACAACAGAGGCCATACGG + Intronic
1066054577 10:31668528-31668550 CTGTTACAAAAGAGGTTGTAGGG - Intergenic
1066471362 10:35701325-35701347 CAGTGACAAAGGAAGCTGCAAGG - Intergenic
1066665160 10:37775868-37775890 CAGTTGCAACAGAACCTGGCAGG + Intergenic
1067992899 10:51235999-51236021 CAGCTACACCAGAAACTCTAAGG - Intronic
1068422401 10:56812423-56812445 CAGTCACAAAGGAAGCTGCATGG + Intergenic
1069153561 10:64997276-64997298 CAGTAAAAACAGCAACTGTAGGG + Intergenic
1069371402 10:67751151-67751173 CAGCTTCAACAGAAACTGGAGGG + Intergenic
1069383264 10:67861836-67861858 GAACTACAACAGAATCTGTAGGG - Intergenic
1069394701 10:67976115-67976137 TAGTTGCAACAAAAACTGTATGG + Intronic
1069716993 10:70527542-70527564 TAGTTGCAACAGGCGCTGTATGG + Intronic
1070001639 10:72382536-72382558 GAGTTAGAACAGAAGGTGCAGGG + Intronic
1071484457 10:86089452-86089474 CAGCTAAAACAGAAGGCGTAAGG + Intronic
1072449048 10:95524662-95524684 TAGTTACAACAGAGAATGTATGG + Intronic
1072550622 10:96474509-96474531 CAGCTAGAACAGAGGCTGTAAGG + Intronic
1073202073 10:101743659-101743681 TAGTTGCAACAGAGACTGTATGG - Intergenic
1074607314 10:114986236-114986258 CAGTTGCAACAGAAACCCTATGG - Intergenic
1074643717 10:115419467-115419489 CAGTTAAAAGAGAGGCTGAACGG + Intronic
1075974571 10:126684432-126684454 CAGTCGCAACACAGGCTGTATGG + Intergenic
1078510197 11:11979257-11979279 CAGATACAGCAGCAGCTGTCAGG - Intronic
1080333628 11:31171276-31171298 TAGTTGCAACAGAAATTGTATGG - Intronic
1080336655 11:31205279-31205301 TAGTTGAAACAGAGGCTGTATGG + Intronic
1081376619 11:42367170-42367192 CAATCACAACAGAAGGTGAAAGG - Intergenic
1082176511 11:49066254-49066276 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1083327421 11:61879862-61879884 CAGTTGAAAGTGAAGCTGTAGGG - Intronic
1084105716 11:66978968-66978990 CAGCGAAAACAGAAGCTGCAAGG - Intergenic
1084467548 11:69334963-69334985 CTGTTACAACAGAAGCCGATGGG - Intronic
1084686150 11:70696718-70696740 CATTTACAAGAGAAGCGGTTGGG + Intronic
1086473539 11:87144356-87144378 TAGTTGCAACAGAGACTGTATGG - Intronic
1086689202 11:89769621-89769643 CAGGAGCAGCAGAAGCTGTAAGG + Intergenic
1086716656 11:90070350-90070372 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1090123741 11:124062671-124062693 AAGAAACAACAGAAGCTGAAAGG - Intergenic
1091178396 11:133581524-133581546 CACTTACAACAAAAGCAGCAAGG + Intergenic
1092307079 12:7312073-7312095 TAGTTACAACAGAAACTGTATGG + Intronic
1092348669 12:7737809-7737831 CAGTTGCAACAGAAACCGTATGG - Intronic
1092485489 12:8899123-8899145 CAGTCGCAATAAAAGCTGTAAGG + Intergenic
1095857433 12:46875390-46875412 CAGTGAAAACAGAAGCTTTCAGG - Intergenic
1096756927 12:53807427-53807449 AAGTGACGACAGAAGCTGCATGG - Intergenic
1098628558 12:72701793-72701815 TAGATAAAACAGAAACTGTATGG + Intergenic
1099445127 12:82743030-82743052 CAGTTGCAATAGTAGCTGTGTGG + Intronic
1100703196 12:97170219-97170241 CTTTTACATCAGTAGCTGTAAGG + Intergenic
1101363300 12:104047997-104048019 CAGTTGCAACAGAAACCATATGG + Intronic
1101470595 12:104993264-104993286 CAGTCACAACAGAGACAGTAAGG - Intronic
1102033096 12:109754508-109754530 AAATTACAAAAGAAACTGTATGG - Intronic
1102201113 12:111058614-111058636 CAGATACAGGAGAAGCTGGAGGG + Intronic
1103625740 12:122218088-122218110 TAGTTTCAACAGAGGCTGTAAGG - Intronic
1104123605 12:125822317-125822339 CAGGGACCTCAGAAGCTGTAGGG + Intergenic
1105699348 13:22924437-22924459 CAGCTACACTAGAAGCTGAAGGG + Intergenic
1105851053 13:24336972-24336994 CAGCTACACTAGAAGCTGAAGGG + Intergenic
1106362412 13:29044583-29044605 CACTTTGAACAGGAGCTGTAGGG - Intronic
1106916947 13:34525920-34525942 TAGTTGCAACAGAAACCGTATGG - Intergenic
1107525276 13:41224629-41224651 CAGTTACATCAGAATCTCTGGGG + Intronic
1107574452 13:41702666-41702688 TGGTTGCAACAGAATCTGTAGGG + Intronic
1109213530 13:59562763-59562785 CCGTTCCAGCAGAAGCTGCAGGG + Intergenic
1109287540 13:60428045-60428067 CAGCAACCACAGAAGCTGTAAGG - Intronic
1109334583 13:60976966-60976988 CAGTTCTATCAGAATCTGTAGGG + Intergenic
1109576478 13:64265229-64265251 CAGTCAAGACAGAAGCAGTATGG + Intergenic
1109772635 13:66997286-66997308 CAATTATAACAGAAGGTGAAGGG + Intronic
1110027973 13:70566508-70566530 CTGTTACAAGAAAAGTTGTATGG - Intergenic
1110500305 13:76219655-76219677 CAGTTAAGACAAAAGCAGTAGGG - Intergenic
1111730113 13:92064346-92064368 CAATTACATCAGAAACTCTAGGG - Intronic
1112032755 13:95472709-95472731 CAGGTAAAACAGAAACTCTAAGG + Intronic
1112388086 13:98958515-98958537 CAGTTGTGACAGAAACTGTAAGG - Intronic
1113866129 13:113526296-113526318 CACTTAAAACAGAAACTGTATGG - Intronic
1116040265 14:39677902-39677924 CAGTTGCAACAGAGACTGTATGG - Intergenic
1117134706 14:52722840-52722862 TAGTTACAACAGAAACCATATGG + Intronic
1118140826 14:63080164-63080186 CAGTTATGACAGAAGGTGAAAGG - Intronic
1118740107 14:68733322-68733344 CAGTTACAGCAGAAGCTGGAAGG + Intergenic
1118983057 14:70731531-70731553 TAGTTACAACAGAAACTGTACGG + Intronic
1120055180 14:79916009-79916031 CATTTAAAACAGAGGCTTTAAGG + Intergenic
1120281141 14:82439352-82439374 CAATTACAGCAGAAGGTGAAGGG - Intergenic
1120362999 14:83529796-83529818 ATGTTACAACAGAATCTGAAAGG - Intergenic
1120922572 14:89768214-89768236 CAGTTGTAACAGAAACTGTGTGG + Intergenic
1121005608 14:90488926-90488948 CAGCTAAAACAGAACCTGTATGG - Intergenic
1121317489 14:92970932-92970954 CACTTTCAAAAGATGCTGTAAGG - Intronic
1121836204 14:97094644-97094666 CAGTTGCAACAGAGATTGTATGG + Intergenic
1123917392 15:25046439-25046461 CAGTTACAAGAGAGAATGTATGG + Intergenic
1124568995 15:30842882-30842904 CAGTTGCAACAGAGACTATATGG - Intergenic
1125878871 15:43174838-43174860 CAATTACATCAGAATCTCTAGGG + Intronic
1126293708 15:47112504-47112526 TAGTTGCAACAGAGACTGTATGG - Intergenic
1128117946 15:65123944-65123966 TAGTTGCAACAGAGACTGTATGG - Intronic
1129496863 15:75991199-75991221 TAGTTGCAACAGAGACTGTATGG - Intronic
1132571876 16:647791-647813 CAGGTGCAACAGCAGCTGGATGG + Exonic
1133441179 16:5822191-5822213 CAGTGACAACATAAGATGTTTGG - Intergenic
1134435182 16:14250363-14250385 CAGTTACAATATCAGCAGTATGG + Intronic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1135852623 16:25978360-25978382 TAGTTACAACAGAGACTGTAGGG - Intronic
1138068231 16:53964229-53964251 CAGTTGTCACAGAAACTGTATGG - Intronic
1139554975 16:67702149-67702171 TAGGTACAACAGAAGCCATACGG + Intronic
1139837889 16:69854377-69854399 CAGTTCCAACAGAATCCGAAAGG - Intronic
1141295571 16:82765424-82765446 CAGTTAAAATAGAAGGAGTAGGG - Intronic
1143424471 17:6823232-6823254 CAGTTACTTCTGAAGCTGGAGGG - Intronic
1145052291 17:19672185-19672207 TAGTTGCAACAGAGGCTGAATGG + Intronic
1148165028 17:45477556-45477578 TAGTTACAACAGAGGTTGTGTGG - Intronic
1148773633 17:50080918-50080940 TAGTTGCAACAGAAACTCTATGG - Intronic
1149196176 17:54124248-54124270 CAGTTACAAGAAAAGCTGTCGGG - Intergenic
1149380403 17:56087839-56087861 TAGTCACAACAGAGCCTGTATGG + Intergenic
1150396258 17:64824281-64824303 TAGTTACAACAGAGGTTGTGTGG - Intergenic
1150721249 17:67616043-67616065 CATTTACTAAAGAGGCTGTAAGG - Intronic
1154069053 18:11136419-11136441 CAGTCACAAGAGAAGATGAAAGG - Intronic
1156544665 18:37952151-37952173 TACTTGCAACAGAAACTGTATGG - Intergenic
1157339154 18:46763954-46763976 GAGTTGCAACAGAACCTGTCTGG - Intergenic
1157473118 18:48004898-48004920 TAGTTGCAACAGAAACTGTATGG + Intergenic
1158429513 18:57372559-57372581 GAGTTACAACAGAAGCCATAAGG - Intergenic
1158887471 18:61841883-61841905 CAGTTGTAACAGATGCTGTGTGG - Intronic
1159110452 18:64050011-64050033 TAGTTGAGACAGAAGCTGTATGG + Intergenic
1159148900 18:64494613-64494635 CTGATACAACAGAAGCAGAAGGG + Intergenic
1159943705 18:74428005-74428027 CAGTTGCTACAGAAGCTGGCAGG + Intergenic
1161948273 19:7452425-7452447 CAGTCACAACAGGAGGTGGAGGG + Intronic
1162251430 19:9447176-9447198 CATTGACAAAATAAGCTGTAAGG + Intergenic
1162490622 19:10989244-10989266 CAGTTACAGCTGGAGCTGCAGGG - Intronic
1163614017 19:18316051-18316073 CAGTGACAAGGGAAGCTGAAAGG + Exonic
1163846644 19:19641969-19641991 CACTCACAACAGTGGCTGTAGGG + Exonic
1165140077 19:33694067-33694089 AAACTACAACAGAATCTGTATGG - Intronic
926604305 2:14881779-14881801 TAGTTACAACAGAGCCTGTATGG + Intergenic
927293955 2:21431990-21432012 CAGGGAGAACAGAAGCAGTAAGG + Intergenic
928601129 2:32904453-32904475 CAGTTGCAACCCTAGCTGTAAGG - Intergenic
928861578 2:35863644-35863666 CAGTTCCGACAGAAGTTCTATGG - Intergenic
929499772 2:42480474-42480496 TAGTTGCAATAGAAACTGTATGG - Intronic
931626874 2:64264229-64264251 CAGTCGCAACAGAAACTTTATGG - Intergenic
932547889 2:72734517-72734539 TAGTTACAACAGAGATTGTATGG - Intronic
933682280 2:85112773-85112795 CAGTTGCAACAGAAACCATATGG - Intergenic
935609431 2:105005655-105005677 TAGTTGCAACAGAGGCCGTATGG - Intergenic
936841729 2:116777865-116777887 TTGTTACAACAGAAGCCTTAAGG - Intergenic
937182753 2:120011359-120011381 CAGTGAAAACAGAAGCTCTGAGG - Intergenic
937655439 2:124369472-124369494 CAATTAAAACAGAATCTGTAAGG + Intronic
939026706 2:137022836-137022858 TAGTTGCAACAGAAACTTTATGG - Intronic
941501804 2:166288368-166288390 CGGTTACAACAGAGGCTCTGCGG - Intronic
942143412 2:173001258-173001280 CATTTAAAACAGAATCTGGAAGG - Exonic
942221856 2:173776511-173776533 CAGTCAGAAAAGATGCTGTATGG - Intergenic
942242916 2:173980173-173980195 CAGAGACAGCCGAAGCTGTAGGG - Intergenic
942649553 2:178152270-178152292 TAGTTGCAACAGAAGTTGTACGG + Intergenic
943046674 2:182868166-182868188 CATTTACAATATAAGCTGAAAGG - Intergenic
943992692 2:194717331-194717353 CAGTTTCAACTGAATGTGTATGG - Intergenic
947181451 2:227415034-227415056 TAGTTACAACAGAAGCTGTATGG + Intergenic
1169114115 20:3051876-3051898 CAGTTCCAACAGCAGCAGCAGGG - Intergenic
1169981858 20:11393766-11393788 CAGTTAAATCAGAATCTCTAGGG + Intergenic
1170115928 20:12859411-12859433 CAGTTCCACCATACGCTGTAGGG + Intergenic
1170552275 20:17488424-17488446 TAGTTACAGCAGAGGCTGTGTGG + Intergenic
1170854553 20:20039195-20039217 CAGTGACAACAGAAGTTGCAAGG + Intronic
1172972619 20:38884443-38884465 TAGGTACAACAGAGACTGTATGG - Intronic
1172980371 20:38937129-38937151 CAGTTACAACAGGAGACGTGAGG - Intronic
1173017167 20:39236202-39236224 TAGTTGCAAGAGAAACTGTACGG - Intergenic
1173929757 20:46808819-46808841 TCGTTCCAACAGAAACTGTATGG + Intergenic
1174197503 20:48783943-48783965 CAGTCACAACACAAGGTGAACGG + Intronic
1174729976 20:52906559-52906581 TAGTTGCAACAGAGACTGTATGG - Intergenic
1174781242 20:53390935-53390957 TAGTTGCCAAAGAAGCTGTATGG - Intronic
1177728102 21:24994086-24994108 CAGTTACAACAGCTGCTAAAGGG - Intergenic
1178074915 21:29006036-29006058 TAGTTGCAACAGAGGCTGAAAGG + Exonic
1180220127 21:46353265-46353287 CTGTTACAGCAGAGGCTGCAGGG + Exonic
1180606363 22:17061840-17061862 CAGTTACAGCAGAATGTGTGGGG - Intergenic
1181139623 22:20794911-20794933 CAGTTACAACAGAAGCTGTATGG + Intronic
1182130475 22:27846641-27846663 TAGTTGCAACAGAGACTGTATGG + Intergenic
1183013347 22:34965792-34965814 TAGTTACAACAGAGAATGTATGG + Intergenic
1184501365 22:44875729-44875751 CAGTTAAAACAGTACCTGGAGGG + Intergenic
1184750196 22:46481417-46481439 CAGTTGAAGCAGAAGCTGGAAGG - Intronic
949379055 3:3424193-3424215 CAGAAACAATAGAAGCTGAAAGG + Intergenic
953558977 3:43970225-43970247 TAGTTGCAACAGAAGCGATATGG + Intergenic
954963979 3:54594225-54594247 TAGTTACAGCAGAAATTGTATGG - Intronic
955684937 3:61540062-61540084 CAATTACATCAGAAGCTCTGGGG - Intergenic
956326073 3:68054393-68054415 CACTCACAACAGAAGGTGAAGGG - Intronic
956345542 3:68273877-68273899 CAGGTACAACACAATCTCTAAGG + Intronic
956397041 3:68837116-68837138 TAATTGCAACAGAGGCTGTATGG + Intronic
956857870 3:73293770-73293792 TAATTACAACAGAAACTGTATGG + Intergenic
956939176 3:74136819-74136841 CAGCTACAACAGGAACTGGAGGG + Intergenic
960083854 3:113569772-113569794 CAATTAAATCAGAGGCTGTAGGG + Intronic
962900796 3:139759626-139759648 TAGTTGCAACAGATACTGTATGG + Intergenic
964166965 3:153719316-153719338 TAGTTGCAACAGAGTCTGTATGG - Intergenic
964340997 3:155708164-155708186 CAATTACATCAGAATCTCTAGGG + Intronic
964874126 3:161346927-161346949 CAGTGAGGCCAGAAGCTGTAGGG + Intronic
965988685 3:174789133-174789155 CAGTTACAAATGAAGCAATATGG - Intronic
966988013 3:185199945-185199967 TAGTTGCAACAGAGACTGTATGG + Intronic
967365918 3:188686380-188686402 GAGTTGCAAGAGAAGCTGTGGGG - Intronic
971021343 4:22539279-22539301 CAGTTGCAACAGAAACCATATGG - Intergenic
971462898 4:26921445-26921467 TAGTTACAACAGCAACTGCATGG - Intronic
971632369 4:29010091-29010113 CAGTTTCAACAACAGCTGGAAGG + Intergenic
971718575 4:30214670-30214692 ATGTTAAAACAGAAGCTTTAGGG - Intergenic
972247745 4:37263117-37263139 CAGGGACAACAGGAGCTGCATGG + Intronic
972369117 4:38405457-38405479 TAGTTGCAACAGACACTGTAAGG - Intergenic
972855424 4:43099880-43099902 TAGTTACCACAGAGACTGTATGG - Intergenic
972945614 4:44251307-44251329 AAGTTACATGAGAAGCTGAAGGG - Intronic
973533664 4:51858869-51858891 TAGTTGCAACAGAGACTGTATGG + Intronic
976339818 4:83934620-83934642 GAGTTACAGCAGAAGTTGTCAGG + Intergenic
976468240 4:85396077-85396099 TAATGACAACTGAAGCTGTAGGG - Intergenic
976502984 4:85813967-85813989 CAATTACAGCAGAAGGTGAAAGG + Intronic
978843753 4:113247491-113247513 GAGTAACAACAGGAGCTTTATGG - Intronic
980238585 4:130141826-130141848 CAGTTCCAACAATAGCTGTACGG + Intergenic
982220451 4:153120351-153120373 TAGTTATAACAGAAACTGTATGG - Intergenic
982998587 4:162382675-162382697 CTGTTACTACAGAAACTGTGGGG + Intergenic
983063037 4:163179433-163179455 CAGTTACAACAGGTGCTAAAGGG - Intergenic
983198290 4:164832668-164832690 TAGTTGCAACAGAAACTATATGG - Intergenic
984103318 4:175513977-175513999 CAGTCACAGCAGAAGGTGAAGGG - Intergenic
986601441 5:9477161-9477183 CAGTCACAGCAGAAGATGAAGGG - Intronic
986760411 5:10875181-10875203 CAGAAATAACAGCAGCTGTAGGG - Intergenic
987438366 5:17925666-17925688 CAGTTACTACTGAAGCTGCTGGG + Intergenic
987441287 5:17960244-17960266 CAGGTACAATGGAAGCTGTTAGG - Intergenic
989085106 5:37667692-37667714 CAGTTGCAACAGAGTCTGTATGG + Intronic
990173464 5:53081072-53081094 CAATTAAATCAGAAGCTCTAGGG + Intronic
990388228 5:55290026-55290048 TAGTTGTAACAGAGGCTGTATGG + Intronic
992241312 5:74772544-74772566 CAGTTGCAACAGAGGCCATATGG + Intronic
993005757 5:82426602-82426624 CAGTTGCAAAAGCAGCTGAAAGG - Intergenic
993447011 5:88025633-88025655 CAGTTGTAACAGAGGCTGTATGG - Intergenic
993993611 5:94691345-94691367 CTGATAGAACAGAAGCAGTATGG + Intronic
993996099 5:94724915-94724937 AAGCCACAACAGAAGCTGTGAGG + Intronic
994680068 5:102875718-102875740 CAGTCAAAACAGAACCTATATGG - Intronic
997856781 5:137379784-137379806 ATGTGACAATAGAAGCTGTAAGG + Intronic
998873298 5:146574656-146574678 CAGTCACAACAGAGACTGTATGG + Intergenic
999353559 5:150902514-150902536 TAGTTACAACAGAAACCGTATGG - Intronic
999683213 5:154079055-154079077 TTGTTGCAACAGAAACTGTATGG + Intronic
999792726 5:154957306-154957328 CATTTACAACAGAAAATTTAGGG - Intronic
1000983323 5:167840417-167840439 CAGTTATAACAGGATCTGTATGG - Intronic
1004165131 6:13250107-13250129 TAGCTGCAACAGAAACTGTATGG + Intronic
1004648892 6:17589384-17589406 CAGTTAAATCAGAATCTTTAGGG + Intergenic
1004983096 6:21048142-21048164 CAGTTGCAACAGAAACTGCATGG - Intronic
1006691095 6:35886410-35886432 CAGTTAGCACAGAAACTTTAAGG - Intronic
1008737155 6:54558970-54558992 CAGTTAAGACAGAAATTGTAGGG - Intergenic
1009607654 6:65895329-65895351 CAGTTACAGCAGAAGGTAAAGGG + Intergenic
1009773034 6:68168672-68168694 CACTTACAACAGAATCTTCAAGG - Intergenic
1009839439 6:69049555-69049577 CAGTTACAAAAGAATTTGCAGGG - Intronic
1010383310 6:75248899-75248921 CTGGTACAACAAAAGTTGTATGG + Intronic
1010585554 6:77654026-77654048 TAGTTACAACAGAAACAGTATGG - Intergenic
1012812716 6:103981404-103981426 TATTTTCAACAGAAGCTATATGG + Intergenic
1012879443 6:104767969-104767991 CATTTAGAATTGAAGCTGTAGGG - Intronic
1013054968 6:106574605-106574627 CAACTACATCAGAACCTGTAGGG + Intronic
1013386552 6:109637612-109637634 CAGTTAAAACAGAATTTCTAGGG - Intronic
1013455406 6:110325319-110325341 GAGTTGCAACAGAAACTGTGTGG - Intronic
1013748615 6:113375068-113375090 ATGTTACATCAGGAGCTGTAGGG - Intergenic
1015969359 6:138728800-138728822 TAGTTACAGCAGAAGCTTTGAGG + Intergenic
1021170398 7:17392263-17392285 CAGTCACAGCAGAAGGTGAAGGG + Intergenic
1021797531 7:24272073-24272095 AAGTTACAACAGACACTGTATGG - Intergenic
1023606572 7:41936761-41936783 CAGTTTCAACAGAGGCTGACAGG - Intergenic
1027455034 7:78379553-78379575 CAGTAACTACAGGAGCTGTGAGG + Intronic
1030260027 7:107554162-107554184 TAGTTGCAACAGAGACTGTATGG + Intronic
1030656051 7:112169188-112169210 CAGTCACAGCAGAAGGTGAAGGG - Intronic
1031715313 7:125101933-125101955 CAGTCACCACAGAAGGTGAAGGG - Intergenic
1031961607 7:127995087-127995109 TAGTTACGACAGAGGCTATATGG + Intronic
1032708861 7:134445254-134445276 CAGCTACAACAGGAACTGGAGGG - Exonic
1032719504 7:134538979-134539001 CAGCTTCAACAGAAACTGGAGGG + Exonic
1032724469 7:134577748-134577770 CAGCTTCAACAGAAACTGGAGGG + Exonic
1033488514 7:141816279-141816301 TAGTTACATCAGAGTCTGTAAGG + Intergenic
1034852060 7:154502576-154502598 CAGTCACAGCAGAAGGTGAAAGG - Intronic
1034946636 7:155266684-155266706 CAGTCACAGCAGAAGCTGGGAGG + Intergenic
1037892554 8:22631055-22631077 AAGTTGCAACAGAAATTGTATGG - Intronic
1038584941 8:28779834-28779856 CAGTTACACCAGAAGCACTGGGG - Intronic
1038707196 8:29905572-29905594 CTGTTACAGCAGCAGCAGTAAGG - Intergenic
1038853598 8:31305846-31305868 TAGTTACACAAAAAGCTGTATGG - Intergenic
1040733067 8:50473287-50473309 CAGTTATAGCAGAAGGTGAAGGG - Intronic
1041593954 8:59624199-59624221 CAATTACATCAGAACCTGTGAGG - Intergenic
1044720540 8:95141495-95141517 CAGCTGCAGCAGAGGCTGTAGGG - Intronic
1045145987 8:99345390-99345412 CAGTTGCAATAAAGGCTGTATGG - Intronic
1045262427 8:100588534-100588556 CAGTTGCAACAGAGACTGTATGG + Intronic
1045671665 8:104561045-104561067 TAGTTGCAACAGAAACCGTATGG - Intronic
1046863823 8:119124014-119124036 CAGTTACAGCAGAGACTGTAGGG + Intergenic
1047821246 8:128523518-128523540 TAGTTGCAACAGAGACTGTATGG + Intergenic
1048612978 8:136043909-136043931 TAGTTATAACAAAAACTGTATGG + Intergenic
1048744845 8:137602742-137602764 TAGTTGCAACAGAAGCCCTAAGG + Intergenic
1050294630 9:4193384-4193406 TAGTTACAACAGAAACCATATGG + Intronic
1051135290 9:13913213-13913235 CAGTTGCAACAGAGACTGTGTGG - Intergenic
1053362327 9:37497625-37497647 TAGTTGCAACAGAGGTTGTATGG + Intronic
1053463102 9:38285727-38285749 CAGTTACTCCAGAGGCTGAAAGG - Intergenic
1054938423 9:70713839-70713861 CAATTACATCAGAATCTCTAGGG + Intronic
1054940114 9:70731832-70731854 CAATTACATCAGAATCTCTAGGG + Intronic
1057961508 9:99461864-99461886 CAATCACAACAGAAGGTGAAGGG - Intergenic
1058007368 9:99931618-99931640 TAGTTGCAACAGAGACTGTATGG + Intronic
1058599617 9:106655030-106655052 CATTCACAACAGAACCTGTGTGG + Intergenic
1059522309 9:114955086-114955108 TAGTTGCAACAGAGGCTGTCTGG - Intergenic
1060271104 9:122142431-122142453 CAATTACAACAGAATCTCTGCGG + Intergenic
1185715615 X:2339622-2339644 CAGTGACAACAGACGATGTTTGG + Intronic
1186410157 X:9339729-9339751 CAGTTTCAACAGAAGCATAAAGG - Intergenic
1186498273 X:10029987-10030009 CAGTTGCAACAGAATCTCCATGG - Intronic
1186521078 X:10207417-10207439 CAGCTACAACAGAAATTGCATGG - Intronic
1186547922 X:10470242-10470264 TAGTTGCAACAGAGACTGTATGG - Intronic
1186750549 X:12617389-12617411 TAGTTGCAACAGAAACTGTCTGG + Intronic
1187094821 X:16136723-16136745 CAGTTGCAATAGAGACTGTATGG - Intronic
1187575890 X:20554872-20554894 TAGTTTTAACAGAAACTGTATGG + Intergenic
1187584076 X:20640527-20640549 CAGTCACAGCAGAAGGTGAAGGG + Intergenic
1188303930 X:28539317-28539339 TAGTTTAAACAGAAGCTGTGCGG + Intergenic
1189182043 X:39013685-39013707 TAGTTGCAACAGAGACTGTAGGG + Intergenic
1189207640 X:39255680-39255702 CAGTAACAGCAGAAGCTGCCAGG + Intergenic
1190507379 X:51139466-51139488 AAATGACAACAGAAGGTGTAGGG - Intergenic
1192126658 X:68507152-68507174 CAGTTGCAACAGAAACCATATGG + Intronic
1192619180 X:72659821-72659843 TAATTGCAACAGATGCTGTATGG - Intronic
1195673403 X:107487687-107487709 CAGTTACACCAGAATCTCTGTGG + Intergenic
1196424116 X:115552277-115552299 TAGTTGCAACAGACACTGTATGG + Intergenic
1196572012 X:117277248-117277270 TAGTTGCAGCAGAAACTGTATGG - Intergenic
1196685862 X:118509798-118509820 CACTTCCTCCAGAAGCTGTAGGG + Intronic
1196991848 X:121338071-121338093 TAGTTACTACAGAGACTGTATGG + Intergenic
1197195102 X:123691983-123692005 TAGTTACAACAGAAACCATATGG + Intronic
1197587006 X:128360814-128360836 TAGTTATAACAGAGACTGTATGG - Intergenic
1197822798 X:130558571-130558593 CAGTTTCAGTAGAAGGTGTATGG - Intergenic
1198244034 X:134811883-134811905 GAGTTGCAACAGATACTGTATGG + Intronic
1198501940 X:137258748-137258770 TAGTTGCAACAGACACTGTATGG + Intergenic
1199901516 X:152177217-152177239 CAGTTAAAACAGGAGGTGGACGG + Intronic