ID: 1181141632

View in Genome Browser
Species Human (GRCh38)
Location 22:20809769-20809791
Sequence GGAACTGCCCAGATGCAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181141625_1181141632 22 Left 1181141625 22:20809724-20809746 CCAATGGGCAGAACGACAACCTG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1181141632 22:20809769-20809791 GGAACTGCCCAGATGCAACTTGG 0: 1
1: 0
2: 0
3: 8
4: 109
1181141629_1181141632 3 Left 1181141629 22:20809743-20809765 CCTGAAAAAGGGTTGGAGACAAG 0: 1
1: 0
2: 0
3: 12
4: 196
Right 1181141632 22:20809769-20809791 GGAACTGCCCAGATGCAACTTGG 0: 1
1: 0
2: 0
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181141632 Original CRISPR GGAACTGCCCAGATGCAACT TGG Intronic
900568455 1:3346853-3346875 GGAACTGCTCAGGAGCCACTTGG - Intronic
900574887 1:3378252-3378274 GGCCCTGGTCAGATGCAACTTGG + Intronic
902606056 1:17569971-17569993 GGAACTGCCCCTTTGCAACTTGG + Intronic
905972211 1:42150769-42150791 GGAGCTGCCCAAATGCACATGGG + Intergenic
914998268 1:152563762-152563784 GGTATTGCCCAGATGCAGTTTGG + Intronic
915773490 1:158455730-158455752 GGGAGTGACCAGAAGCAACTGGG - Intergenic
915974945 1:160379221-160379243 GGAGCTGCCCAGAAGGAAGTTGG + Intergenic
917708039 1:177654537-177654559 GGAACTGACCAAATGAAAATTGG - Intergenic
919914109 1:202129542-202129564 GGCAGGGCCCAGATGCAGCTGGG + Exonic
924134268 1:240947191-240947213 AGAACTGCTAAGATGCAACGGGG - Intronic
1063042384 10:2356553-2356575 GGAACTGAAGAGATGAAACTGGG - Intergenic
1063864102 10:10345298-10345320 GGAACTGTCCAGTAGCACCTGGG - Intergenic
1064325071 10:14342317-14342339 AGCACTGCCCAGATGACACTTGG + Intronic
1066195573 10:33096294-33096316 GGATCTGCCCAGATGAAAGAGGG - Intergenic
1069551488 10:69367397-69367419 GGAACTGCCCAGCAGGAAATGGG + Intronic
1075127726 10:119713907-119713929 GGCACTGCCCAGAAGCAGCAAGG - Intergenic
1076164310 10:128269446-128269468 GCACCTGCCCAGCTGCATCTTGG - Intergenic
1081105855 11:39068081-39068103 GGGACTGCCCAGATTCAAAGGGG + Intergenic
1083267411 11:61553209-61553231 GGATCTTCCCAGTTGGAACTGGG - Intronic
1084601380 11:70147753-70147775 GGAGCTGCCCAGAAGAAGCTGGG - Intronic
1084671020 11:70606721-70606743 GGAGCTGCCCAGGTGCAAGATGG + Intronic
1085126208 11:74004393-74004415 GGCACCACCCAGAGGCAACTGGG - Intronic
1092928892 12:13296579-13296601 GGAACTTCTGGGATGCAACTGGG + Intergenic
1096109709 12:49021458-49021480 GGAACTACCCAGAAGCATCTGGG - Exonic
1096583854 12:52606664-52606686 GGACCTGTTCAGATGCAACGTGG + Intergenic
1101153840 12:101908779-101908801 GGAAGTGCACAGATGGACCTAGG + Intronic
1101242234 12:102849902-102849924 GGAACTGTCCAGATCAAAGTTGG + Intronic
1101587092 12:106094589-106094611 GGAACTGCACTGAATCAACTCGG - Intronic
1101649925 12:106668112-106668134 GGAGCTGCCCAACTGCAGCTGGG - Intronic
1102721454 12:115020166-115020188 GAATCTTCCCAGATGAAACTTGG - Intergenic
1107963355 13:45578044-45578066 GGAAGTGCACAGATGGACCTAGG - Intronic
1107966194 13:45600313-45600335 GGAAGTGCACAGATGAATCTGGG - Intronic
1108481243 13:50874146-50874168 GGAAGTGCCCAGATGGGGCTAGG + Intergenic
1111397308 13:87679389-87679411 GGATCTGTACAAATGCAACTGGG - Exonic
1111532238 13:89552944-89552966 CTAAATGCACAGATGCAACTTGG - Intergenic
1118157399 14:63255314-63255336 GGAAATGCAGAGAGGCAACTGGG - Intronic
1119186880 14:72649380-72649402 GGAACTGCCAGGATGCACTTTGG + Intronic
1121781970 14:96627815-96627837 GGAGCTGCCCACCTGCACCTGGG - Intergenic
1122299238 14:100722688-100722710 GGGACTGCCCAGAGTCCACTGGG - Intergenic
1122366341 14:101197023-101197045 GGGATGGCCCAGAGGCAACTGGG + Intergenic
1122698548 14:103570937-103570959 GGACCCGCCCAGAAGCCACTCGG - Intronic
1125014656 15:34920628-34920650 GGGACTGCCCAGAAGGATCTTGG - Intronic
1129236417 15:74226298-74226320 ATAACTGCTCATATGCAACTGGG - Intergenic
1131929651 15:97426988-97427010 GTAAATAGCCAGATGCAACTTGG - Intergenic
1132699047 16:1214504-1214526 GGTACTGCCCAGATGGACCTGGG - Intronic
1137442398 16:48508231-48508253 TGATCTGCCCAGAGCCAACTTGG - Intergenic
1138149848 16:54646661-54646683 GGAACTTCCCACATACAACAAGG + Intergenic
1138728959 16:59173603-59173625 GGAACTGCCCAAAAACAGCTGGG - Intergenic
1140377364 16:74455275-74455297 GAAACAGCCCAGATGCCTCTGGG - Intronic
1148047071 17:44750760-44750782 GGAAGTGACCAGATGAGACTGGG - Exonic
1151124657 17:71831860-71831882 AGAACTGGCCAGATGCAATTTGG + Intergenic
1152586922 17:81193326-81193348 GGTCCTCCCCAGATGCAGCTTGG - Intronic
1152616143 17:81338783-81338805 GGACCTGCCCAGATGCCTGTGGG + Intergenic
1153103388 18:1500027-1500049 AGAACTTCCCCGATCCAACTAGG + Intergenic
1158623422 18:59051580-59051602 GGAAATGCCCAAATTCCACTGGG + Intergenic
1158661770 18:59395104-59395126 AGAATTGACCAGATGCAACAAGG - Intergenic
1163405168 19:17117418-17117440 GGGAGTGCCCAGAGGCAGCTTGG + Intronic
1164457868 19:28423552-28423574 GGAACTGGGCAGAAGCAACTAGG + Intergenic
1165608593 19:37130445-37130467 GGAACTGCCCAAATTAAGCTAGG + Intronic
925207629 2:2020917-2020939 GGAGCTGCTCAGAGGCAGCTGGG - Intronic
925923384 2:8653187-8653209 GGACCTGCCCAGCGGCTACTTGG - Intergenic
930787182 2:55282256-55282278 GGAACTGCCCAGAGGGATCTCGG - Intergenic
931636643 2:64346563-64346585 GCAGCTGCCCACATGCAACCTGG - Intergenic
935737522 2:106118130-106118152 GGACCTGCCCAGTAGCAGCTTGG - Intronic
1169735795 20:8836217-8836239 ATAACTGCCCAGATTCAAGTGGG + Intronic
1170685651 20:18567330-18567352 GGCTCTGCCCCGATGCACCTTGG - Intergenic
1170833230 20:19861412-19861434 GGAAGTGCTCAGAAGCACCTAGG - Intergenic
1173003864 20:39124833-39124855 AGATCTACCCAGATGCCACTAGG - Intergenic
1173522689 20:43711399-43711421 GGACCAACCCAGCTGCAACTGGG - Intronic
1181141632 22:20809769-20809791 GGAACTGCCCAGATGCAACTTGG + Intronic
1183619663 22:38965096-38965118 GGAAGTGCCCAGTTGTCACTGGG + Intronic
1183693685 22:39406496-39406518 GGCACTGCTCAAATCCAACTAGG - Intronic
950291222 3:11785918-11785940 ACCACTGCCCAGATGCCACTTGG - Intergenic
951030205 3:17873010-17873032 AGAACTGACCAGAAGCAATTAGG - Intronic
955808204 3:62758669-62758691 GGATGTGCCCAGATAGAACTGGG - Intronic
961027145 3:123568331-123568353 GGAGCTGTCCAGAGGCAGCTTGG - Intronic
962729451 3:138266631-138266653 GGAAGTGTCCAGTTGGAACTAGG + Intronic
972702156 4:41504444-41504466 GGAACTGCTCAGATGCAAAAAGG - Intronic
977993679 4:103476422-103476444 GGAAGTGCACAGATGAACCTAGG + Intergenic
981925201 4:150131750-150131772 GGACCTGCCAAGATGCAACAAGG - Intronic
982142151 4:152334851-152334873 GGAACTGGCTAGATGTAAATAGG - Intronic
990204245 5:53412008-53412030 GGAACTGCCTTGAGGCTACTAGG - Intergenic
990380636 5:55219466-55219488 TGAACTGCACAGATAAAACTGGG - Intergenic
993953365 5:94202098-94202120 GGAAGTGCACAGATGGACCTAGG + Intronic
994324895 5:98436899-98436921 GGTCCTGCACAGATGGAACTTGG - Intergenic
995145916 5:108787077-108787099 GCAGCTGCCCAGCTGCAGCTTGG + Intronic
996838989 5:127825590-127825612 GGAACCTCCCAGAAGCACCTAGG - Intergenic
998043516 5:138968489-138968511 GGAACTGGCCAGATGAAGATGGG - Intronic
1000339465 5:160266163-160266185 AGCACTGCCCACATGCACCTGGG - Intronic
1002130168 5:177076365-177076387 GGAAGTGCACAGATGGACCTAGG - Intronic
1004260078 6:14100457-14100479 GGAACTACCCAGATGGTGCTGGG + Intergenic
1005214960 6:23515145-23515167 GGAAGTGCACAGATGGACCTAGG - Intergenic
1007659114 6:43471593-43471615 AGAACTGCCCAGCTCCTACTGGG + Intergenic
1013967557 6:115972858-115972880 GGCACTGCCAGGATTCAACTTGG + Intronic
1018509414 6:164509341-164509363 GGATCTGCTCAGATGCACCGTGG - Intergenic
1019037874 6:169076940-169076962 TGAACTGACCAGTTGCACCTGGG + Intergenic
1022771435 7:33477024-33477046 TGAACTGCCCAGGTTCAAGTGGG + Intronic
1023666252 7:42526477-42526499 GAAACTGACCAGATGCAAACAGG - Intergenic
1024886972 7:54154200-54154222 TGAATTGCCCATATGCAATTTGG - Intergenic
1026731149 7:72912802-72912824 GGAAATGCCCTGACTCAACTTGG - Intronic
1031359843 7:120836209-120836231 GAAACAGACCAGATGCAAATTGG + Intronic
1032850550 7:135791546-135791568 GGAAATGCACAGATTCATCTAGG - Intergenic
1039791523 8:40879591-40879613 GGAACGACTCAGAGGCAACTGGG + Intronic
1044731287 8:95230642-95230664 GGAATTGCCCCGATGCAATGAGG + Intergenic
1052031686 9:23636364-23636386 GGAGCTGCCCAGCTGGTACTGGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1059125975 9:111685392-111685414 GTAACTCGCCAGTTGCAACTTGG - Intergenic
1061528692 9:131192242-131192264 TGAACTGCCCAGAAGCAGATGGG - Exonic
1185928782 X:4176995-4177017 GAAACTGCTCACATACAACTTGG - Intergenic
1189515261 X:41707146-41707168 ATACCTGCCCAGATTCAACTGGG - Intronic
1193639782 X:83998857-83998879 GAAACTGCCCAAATGCCAATTGG - Intergenic
1194133071 X:90106136-90106158 GGAACTGACCTGATGCCAGTAGG + Intergenic
1200397106 X:155997762-155997784 GGGACTGGGCAGATGCATCTGGG + Exonic
1200478861 Y:3676211-3676233 GGAACTGACCTGATGCCAGTAGG + Intergenic