ID: 1181147457

View in Genome Browser
Species Human (GRCh38)
Location 22:20858913-20858935
Sequence GCGGTTGCGCGCGCCGGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 42}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181147452_1181147457 12 Left 1181147452 22:20858878-20858900 CCGCTGCAGGGGAGAGAGGGGAT 0: 1
1: 0
2: 4
3: 36
4: 352
Right 1181147457 22:20858913-20858935 GCGGTTGCGCGCGCCGGATGTGG 0: 1
1: 0
2: 0
3: 5
4: 42
1181147447_1181147457 16 Left 1181147447 22:20858874-20858896 CCCACCGCTGCAGGGGAGAGAGG 0: 1
1: 0
2: 3
3: 24
4: 244
Right 1181147457 22:20858913-20858935 GCGGTTGCGCGCGCCGGATGTGG 0: 1
1: 0
2: 0
3: 5
4: 42
1181147449_1181147457 15 Left 1181147449 22:20858875-20858897 CCACCGCTGCAGGGGAGAGAGGG 0: 1
1: 0
2: 6
3: 34
4: 352
Right 1181147457 22:20858913-20858935 GCGGTTGCGCGCGCCGGATGTGG 0: 1
1: 0
2: 0
3: 5
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181147457 Original CRISPR GCGGTTGCGCGCGCCGGATG TGG Intronic
900508376 1:3042626-3042648 GCGGTGGTGCGTGCCGGGTGCGG - Intergenic
1076916343 10:133424565-133424587 GCGGCTCCGCGCTCCGGCTGAGG - Exonic
1076936450 10:133569360-133569382 GCGGCTCCGCGCTCCGGCTGAGG - Intronic
1085295653 11:75430263-75430285 GCGGCTGCGCGCGGAGGACGAGG - Exonic
1095261726 12:40105878-40105900 GCGGTTGCTCCCGCCGGCTCGGG - Intronic
1102025798 12:109713879-109713901 GAGGCTGCGCGCGCCGGCCGGGG + Intergenic
1103308828 12:119989003-119989025 GCGGCTGCGCGCGCCGCCTGCGG - Intergenic
1109858796 13:68171000-68171022 GCGGCTGCGCGCGGCGCTTGCGG + Intergenic
1110596483 13:77326401-77326423 GCGGGTGCACGCGCGGCATGGGG + Intronic
1118404753 14:65412507-65412529 GCGGCTGCGCACGCCGGCTCCGG - Intronic
1122975216 14:105168227-105168249 GAGGCTGCGCGCGGCGGCTGGGG - Intronic
1125524781 15:40368061-40368083 GCGGCTGTGCGCGCCGGGCGCGG + Exonic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1139147701 16:64343916-64343938 GAGGCTGCGCGCGGCGCATGCGG + Intergenic
1142812363 17:2401230-2401252 ACGTGTGCGCGCGCCGGATCCGG - Intergenic
1146398530 17:32486884-32486906 GCTGAGGCGCGCGCCGGAAGCGG + Exonic
1152535463 17:80948259-80948281 GCGGTTGCGGGCTCCTGGTGAGG + Intronic
1152714433 17:81891684-81891706 ACGGCTGCGCGCGCGGGACGGGG + Intronic
1154202394 18:12308419-12308441 GCGGGTGCGCGCCCCGGCGGGGG - Intronic
1160500710 18:79400121-79400143 GCGGTCGCGCGCGCGCGAGGGGG + Intronic
1161029575 19:2051380-2051402 GCGGCTGCGCGCTCCGGCGGTGG + Intergenic
1161550515 19:4909873-4909895 GGGGTCGAGCGCGCCGGGTGGGG + Intronic
1164658621 19:29942616-29942638 TCCGTTGCGCGCCCCGGATGTGG + Exonic
1168309369 19:55452770-55452792 GGGCGTGCGCGCGCCGGCTGGGG + Intergenic
924985442 2:265168-265190 GCGGGTGCACGGGGCGGATGGGG - Intronic
928093561 2:28391004-28391026 GCGGACGCGCGCGCCGGCCGTGG - Intergenic
933351653 2:81160107-81160129 GCGGTGGCGGGCGCCTGTTGTGG - Intergenic
940666743 2:156618397-156618419 GCGGCTGCGCGCGGCGCTTGCGG - Intergenic
1176110040 20:63406983-63407005 GCGGTTGCCCCCGCCGTAGGCGG + Exonic
1180741083 22:18053696-18053718 GGGGCTGCGCGCGCCGCTTGCGG - Intergenic
1181147457 22:20858913-20858935 GCGGTTGCGCGCGCCGGATGTGG + Intronic
1184184614 22:42856726-42856748 CCGGCTGCTGGCGCCGGATGCGG - Intronic
950345321 3:12287842-12287864 GCGGGCGCGGGCGCCGGCTGGGG - Intronic
976719786 4:88158720-88158742 GCGCTCGGGCGCGCCGGGTGTGG - Exonic
983752810 4:171298296-171298318 GCGGCTGCGCGCGGCGCTTGCGG + Intergenic
992530138 5:77645307-77645329 GCGGCGGCGCGGGCCGGCTGGGG - Intergenic
995106539 5:108382070-108382092 GCGGGTGCGCGCGCCGGCGGCGG - Exonic
997304975 5:132830304-132830326 GCGGCTGGGCGCGCCGCGTGTGG - Intronic
1000463311 5:161547817-161547839 GCGGGTGCGCGCAGCGGAGGGGG - Intronic
1007633453 6:43285123-43285145 GGCATTGCGCGCGGCGGATGTGG - Exonic
1033899440 7:146116883-146116905 GCGGCTCCGCGCGCCGGCTGCGG + Exonic
1034911828 7:155003427-155003449 GCGCATGCGCGCGGCGGAGGGGG + Intergenic
1048155578 8:131945933-131945955 GCGGTTGCGAGGGCAGGGTGTGG - Intronic
1049090658 8:140511454-140511476 GCGGTCGGGCCCGCCGGCTGCGG + Exonic
1049651499 8:143771842-143771864 GCGGCTGCGCGAGCAGGAGGAGG + Intergenic
1049713627 8:144078900-144078922 GCGAGTGGGCGCGCGGGATGGGG + Intronic
1062461902 9:136665793-136665815 GCGCGTGCGCGCCCCGGATCCGG + Intronic
1198177800 X:134172872-134172894 GCGCATGCGCGCGCCGGGTGGGG - Intergenic