ID: 1181149773

View in Genome Browser
Species Human (GRCh38)
Location 22:20874935-20874957
Sequence CCCTTGGAGGAGTGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181149767_1181149773 5 Left 1181149767 22:20874907-20874929 CCATGTACAAACTCAGGAGCAGA 0: 1
1: 0
2: 1
3: 10
4: 257
Right 1181149773 22:20874935-20874957 CCCTTGGAGGAGTGGGAAGCTGG No data
1181149766_1181149773 8 Left 1181149766 22:20874904-20874926 CCTCCATGTACAAACTCAGGAGC 0: 1
1: 0
2: 1
3: 7
4: 141
Right 1181149773 22:20874935-20874957 CCCTTGGAGGAGTGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181149773 Original CRISPR CCCTTGGAGGAGTGGGAAGC TGG Intronic
No off target data available for this crispr