ID: 1181150817

View in Genome Browser
Species Human (GRCh38)
Location 22:20882021-20882043
Sequence CAGAGATCTGAAGATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 281}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181150815_1181150817 19 Left 1181150815 22:20881979-20882001 CCTTTTAAGTGGAAAGAGAAGCA No data
Right 1181150817 22:20882021-20882043 CAGAGATCTGAAGATGCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 281
1181150814_1181150817 20 Left 1181150814 22:20881978-20882000 CCCTTTTAAGTGGAAAGAGAAGC 0: 1
1: 0
2: 2
3: 40
4: 374
Right 1181150817 22:20882021-20882043 CAGAGATCTGAAGATGCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181150817 Original CRISPR CAGAGATCTGAAGATGCTGC TGG Intronic
900432484 1:2609444-2609466 CAGAGGCCTGACGAGGCTGCAGG + Intronic
901337149 1:8460285-8460307 AAGGCATCTGGAGATGCTGCTGG + Intronic
901350541 1:8591854-8591876 CAGAAATCTGCACATGCTGAGGG + Intronic
904257807 1:29267479-29267501 CAGAGATCTGAAGGAGGTGAGGG + Intronic
905398734 1:37685897-37685919 CAGAGATCTGAAGAGGGTAAGGG - Intronic
905683999 1:39895970-39895992 CAGAGTTCTGGAGGGGCTGCTGG + Exonic
906112511 1:43333613-43333635 CAGAGAACTCAAGAGGTTGCTGG - Intergenic
906611596 1:47207843-47207865 AAGAGATCTGGAGCTGATGCTGG + Intergenic
907052847 1:51341419-51341441 CACAGATTTGAAGATGTTACAGG + Intronic
910051793 1:82983089-82983111 GAGAAATCTTAAGAGGCTGCGGG + Intergenic
910687757 1:89935327-89935349 CAGTGATATGCAAATGCTGCAGG - Exonic
915566349 1:156715527-156715549 CAGAGGCCTGAAGATACTGAGGG - Intergenic
915775971 1:158486718-158486740 CAGAGATGTGGAGATTCTCCAGG - Intergenic
917141914 1:171842649-171842671 TAGAGAACGGAAGATGATGCTGG - Intronic
917520087 1:175741052-175741074 CAGAAGTCTCAAGGTGCTGCTGG - Intronic
917618730 1:176772888-176772910 CAGATATCTGAGGTGGCTGCTGG - Intronic
918440088 1:184558215-184558237 AGGAGATGTGAAGAGGCTGCTGG - Intronic
919412831 1:197267815-197267837 CAGAGTTCTGAAGATCATTCAGG - Intergenic
921735530 1:218623454-218623476 AAGAAAGCTGAAGATGCTGGAGG + Intergenic
922770178 1:228177399-228177421 CAGAGACCTGAAGACACTGAGGG - Exonic
922798923 1:228355266-228355288 CTGAGATGTGAAGGTGCTGGTGG + Intronic
922885358 1:229016111-229016133 CAGCTATCTGCAGCTGCTGCTGG - Intergenic
1063894003 10:10660008-10660030 GAGAGAGCTGAATATGCTGCTGG + Intergenic
1064975806 10:21113457-21113479 CAGAGATCTGAATAGCCTCCTGG - Intronic
1066370115 10:34813691-34813713 GAGAGAACTGAAGATGCCACCGG + Intronic
1066550009 10:36545721-36545743 CAGTCATCTGAAGAAGCAGCTGG - Intergenic
1066712653 10:38252331-38252353 GTGAGATTTCAAGATGCTGCAGG - Intergenic
1068443299 10:57087917-57087939 CAGAGCTCTGATTATGGTGCTGG + Intergenic
1068924351 10:62519501-62519523 GAGAGATTTGAAGATGCTACTGG - Intronic
1069044473 10:63727960-63727982 CAAAAATCTGATGATGATGCTGG - Intergenic
1069857786 10:71451222-71451244 CTGAGACCTGAGGAAGCTGCTGG - Intronic
1070322763 10:75366697-75366719 CAAAGAACTGCAGATGCTGGTGG - Intergenic
1070667744 10:78357328-78357350 CAGAGATGTGAAAATGCCGGAGG + Intergenic
1071425615 10:85546172-85546194 AGGAGATCTGAAGATGAAGCAGG - Intergenic
1072040286 10:91600424-91600446 CAGAGTTATGAAGGTGCTTCTGG - Intergenic
1073359089 10:102882885-102882907 AAGAAATTTGAAGATGCAGCCGG - Intronic
1073553864 10:104428921-104428943 GACAGTTCTGAAGAGGCTGCTGG + Intronic
1075483418 10:122800481-122800503 CAGAGTTCAGCAGCTGCTGCTGG - Intergenic
1076479909 10:130778093-130778115 CAGAGGTCTGCAGAGGCTGGGGG + Intergenic
1077354320 11:2108129-2108151 CAGCCATCTGAAGGTCCTGCTGG + Intergenic
1078266931 11:9762053-9762075 CAGAGATCTGAAGAAATTGAGGG + Intergenic
1078735701 11:14018626-14018648 CAGAGATCTGCAGAGCATGCTGG + Intronic
1081445994 11:43132052-43132074 CAGAGATTTGAAGACACTGAAGG + Intergenic
1082083369 11:48029102-48029124 CTGAGGGCTGCAGATGCTGCCGG + Intronic
1082866473 11:57904194-57904216 CACAGATCTGAGGATGCAGGAGG - Intergenic
1083932540 11:65853807-65853829 GAGAGGGCTGAGGATGCTGCAGG - Intronic
1083976090 11:66121769-66121791 CAGAGAGGTGAGGAAGCTGCAGG + Intronic
1086048231 11:82558462-82558484 GAGAGATCTGAAGAGTCTTCAGG + Intergenic
1086734219 11:90285670-90285692 GAGAGATGTGAGGAAGCTGCAGG - Intergenic
1088336112 11:108705876-108705898 CAAATTTCTGAAGATGCAGCAGG + Intronic
1088751353 11:112844722-112844744 CAGTGATCAGCTGATGCTGCTGG + Intergenic
1088855960 11:113753822-113753844 CAGAGAGGTGAGGAAGCTGCAGG + Intronic
1090145843 11:124321664-124321686 CAGAACTCTCAAGCTGCTGCTGG - Intergenic
1090398288 11:126433347-126433369 CTGGCCTCTGAAGATGCTGCTGG + Intronic
1091079788 11:132655539-132655561 CAGACATCTACAGATGCTGCGGG - Intronic
1091407575 12:218797-218819 CAGAGAGATGAGAATGCTGCTGG - Intergenic
1094203007 12:27812265-27812287 AAGAGATCTGAAAATACCGCTGG - Intergenic
1096887051 12:54728545-54728567 CAGATGTCTGCAGATGCTGTAGG + Intergenic
1097070989 12:56354810-56354832 CAAAGAGCAGAAGATTCTGCAGG - Exonic
1101506785 12:105354473-105354495 CAGAGAGCTGAAGTAGCTGCTGG + Intronic
1101727061 12:107396484-107396506 CAGAGATCAGCACAGGCTGCTGG - Intronic
1101728886 12:107410426-107410448 CTGAGAGCAGAAGATGCTGGGGG + Intronic
1102027256 12:109720515-109720537 CGGAGATCTGCAGATGCCGAGGG - Intronic
1103345563 12:120247512-120247534 CAGAGATTTGATGTTGCGGCAGG - Intronic
1103960936 12:124608983-124609005 CTGGGAACTGAAGATGCTTCTGG + Intergenic
1104730313 12:131102043-131102065 AAGAGTTCTGAGGATTCTGCAGG - Intronic
1104847508 12:131854097-131854119 CTCAGATCAGAGGATGCTGCAGG + Intergenic
1107686126 13:42900903-42900925 CAGAGATCTCAAAGTTCTGCTGG - Intronic
1109199067 13:59410854-59410876 CAAAGAGCTGATGATGTTGCAGG + Intergenic
1110153762 13:72287860-72287882 CAGAGAGAGGAAGATGCTACAGG + Intergenic
1111247422 13:85558329-85558351 CAGAAATTAGACGATGCTGCAGG + Intergenic
1111536743 13:89611763-89611785 CAGAGCTCTCAAGATGGTGGCGG + Intergenic
1113444246 13:110353283-110353305 CAGAGATTTGAGGAGGCTGCAGG + Intronic
1113461027 13:110482228-110482250 GGGAAATCTGAAGATGATGCAGG - Intronic
1113639297 13:111945714-111945736 CCGACATCTGAGAATGCTGCTGG - Intergenic
1113986984 13:114325139-114325161 CTGAGCTCTGGAGATCCTGCTGG - Exonic
1114331378 14:21640350-21640372 CAGAAACCTGAAGATGATGGTGG - Intergenic
1114669898 14:24404662-24404684 CAGAGATTTGCAGGTGCTGTTGG + Intronic
1114717797 14:24845844-24845866 AAGAGATTTGAGGATGCTGGGGG + Intronic
1115972392 14:38960470-38960492 CTGACATCTGAAGATGCTAAAGG + Intergenic
1116292534 14:43062298-43062320 GAGAAATCTGAACATGATGCAGG - Intergenic
1119005976 14:70929183-70929205 CAGTGATCTAAAGATGCTTTTGG + Intronic
1119319661 14:73722440-73722462 CGGAGATAGGAAGATGATGCTGG + Intronic
1121960755 14:98257306-98257328 CACAGATCAGATGGTGCTGCAGG - Intergenic
1123632924 15:22274586-22274608 CAGGGACCTGGAGACGCTGCAGG - Intergenic
1126471443 15:49015877-49015899 CAGAGATCTAAAGAACCTGAGGG + Intronic
1127152661 15:56094233-56094255 CCGGCATCTGAAGTTGCTGCTGG + Exonic
1127501263 15:59556196-59556218 CAGAGGCCTGAAGAAGGTGCTGG + Intergenic
1127605282 15:60581036-60581058 CAGCCATCTGAAGATGCCTCAGG - Intronic
1128513407 15:68327244-68327266 CAGAGATTTGAGGATCCGGCAGG - Intronic
1128995782 15:72293340-72293362 CACAGATCTGAACATTCTGATGG + Intronic
1129528291 15:76238157-76238179 AGCAGATCTGAAGTTGCTGCAGG - Intronic
1129738741 15:77979713-77979735 AAGAGTTCTGCAGAGGCTGCGGG - Intergenic
1132577648 16:671380-671402 CAGAGCTCTGTGGATGCTGAGGG - Intronic
1132786310 16:1658669-1658691 CAGAGATCAGGAGATGCCGGAGG + Intronic
1133318086 16:4896291-4896313 GAGAGTTCTTAAGAAGCTGCGGG - Intronic
1133972829 16:10579865-10579887 CAGAGATCTGAGCACGCTCCAGG - Intronic
1135494996 16:22943575-22943597 CAGAGATCTGGACATGCAGTAGG - Intergenic
1135843852 16:25900675-25900697 CAGAGAGCTGTTGAGGCTGCAGG + Intronic
1135844161 16:25903063-25903085 CAGAGAGCTGTTGAGGCTGCAGG + Intronic
1137404691 16:48180076-48180098 CAGACACCTGAACATGATGCTGG - Intronic
1138144232 16:54594870-54594892 CAGAGACCTCAAGGTGCTGGAGG + Intergenic
1138270531 16:55692640-55692662 CAGTTATCTGAAGATGCTCAAGG - Intronic
1138423110 16:56912719-56912741 CATAAATCAGAAGATGCTGTTGG + Intronic
1139828232 16:69774607-69774629 CAAAGATCTGAAGAAGCTGAAGG - Intronic
1141304511 16:82849117-82849139 CTGAGAGGTGAAGAAGCTGCAGG + Intronic
1141618339 16:85222500-85222522 CCAAGATCTGAAGCTGCTGGTGG - Intergenic
1142566486 17:843570-843592 GAGAGATCTTAAGAAGCGGCTGG + Intronic
1143622448 17:8088194-8088216 CAAAGGCCTGAAGATGCTGCGGG + Intergenic
1145776416 17:27532166-27532188 CAGACATCTGAAGATGGGTCTGG + Intronic
1146138548 17:30344715-30344737 CTGAGATCTGCAGATCCAGCAGG - Intergenic
1147234185 17:39045077-39045099 CAGAAATCTGAAAATGCCTCCGG - Intergenic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1148279538 17:46337292-46337314 CAGAAATCTGAAAATGCCCCTGG - Exonic
1148301755 17:46555148-46555170 CAGAAATCTGAAAATGCCCCTGG - Exonic
1148365684 17:47054138-47054160 CAGAAATCTGAAAATGCCCCTGG - Intergenic
1149693421 17:58597572-58597594 CAGAGATGTCAAGATGCGGGTGG - Intronic
1150627971 17:66855359-66855381 CAGAGACCTGAAGAGCCTGAAGG - Intronic
1151555299 17:74843442-74843464 CAGCGTGCTCAAGATGCTGCAGG - Exonic
1151557986 17:74856304-74856326 CAGAGATGTGCAGATCCTGGGGG - Intronic
1153427180 18:4978116-4978138 CAGAAATCTGCAGAAGCGGCCGG + Intergenic
1155045385 18:22098585-22098607 CAGAGGTCTGAAGATGGTTTGGG - Exonic
1156216515 18:35004224-35004246 CACAGGTCTGGAGATGTTGCTGG - Intronic
1156350876 18:36299845-36299867 CAGACATCTAAATATACTGCAGG - Intronic
1156462159 18:37327227-37327249 CAGAGACCTGCAGAGGCTGGTGG - Intronic
1156836692 18:41563582-41563604 CAGAGAGATGAAGACCCTGCTGG - Intergenic
1158755163 18:60315479-60315501 AAGAGATCTGAAGATGGACCTGG + Intergenic
1158878098 18:61752117-61752139 CAGAGATGTGGAGATACTGCTGG - Intergenic
1161242410 19:3229672-3229694 CAGAGAACAGAAGAGGCTGTTGG + Intronic
1162033480 19:7927101-7927123 CAGAGGTCTGGAGTTGCCGCAGG + Exonic
1167578126 19:50327534-50327556 CTGAGAGCAGAAGATACTGCAGG + Intronic
1168377068 19:55889147-55889169 CAGATAGCTGAACATGCTGAAGG - Intergenic
1168612103 19:57809575-57809597 CAGAGATGTGAAGATTATTCAGG + Intronic
925585113 2:5457455-5457477 CAGAGACCTGCAGAGGCAGCAGG + Intergenic
926818505 2:16826350-16826372 GAGAGAGGTGAAGAAGCTGCCGG - Intergenic
927864965 2:26582444-26582466 GGGGGATCTGAAGATGCTGGTGG - Intronic
929389949 2:41458596-41458618 CTGTGATCTGATGATGCTGCTGG - Intergenic
929830465 2:45342945-45342967 TAGATCACTGAAGATGCTGCAGG - Intergenic
933722582 2:85407877-85407899 CAGAGATCTAATGAGGCAGCAGG - Intronic
935386568 2:102505504-102505526 AAGAGAACTGAAAATGCAGCAGG - Intronic
935856760 2:107282720-107282742 CAGAGAGCAGAAGCAGCTGCTGG - Intergenic
936440835 2:112551423-112551445 CAGAGAGCAGAAGATGCAGAAGG + Intronic
936558903 2:113519558-113519580 CAGAGATTTGAAGACACTGAAGG - Intergenic
937535387 2:122880210-122880232 GAGAGATGTGAAGATGCTTTGGG + Intergenic
937898337 2:126995932-126995954 CAGAACTCTCAAGCTGCTGCTGG - Intergenic
939165681 2:138639010-138639032 CTGAGATCTGAAGGAGCTGAAGG - Intergenic
939706498 2:145460080-145460102 CTGAGAGCTGAAGATGTTGCTGG + Intergenic
939722827 2:145676708-145676730 CAGAAATCTGAAGATCTTGCGGG + Intergenic
940030904 2:149260286-149260308 CAGGGATCTGAATACTCTGCTGG - Intergenic
940037427 2:149325482-149325504 GAGAGAGGTGAAGAAGCTGCAGG - Intergenic
940240024 2:151552520-151552542 GAAAGCACTGAAGATGCTGCTGG - Intronic
940342681 2:152598121-152598143 CCAAGATCTGAAATTGCTGCAGG + Intronic
942420877 2:175806224-175806246 CACAGCTCTGGAGGTGCTGCAGG + Intergenic
943846654 2:192657561-192657583 CAGTGATCAGTAGATACTGCAGG - Intergenic
944690396 2:202153516-202153538 CAAAGCTCTGAAGATGGTGAGGG - Intronic
945798966 2:214400804-214400826 TAGAGCTCTGAAGATACTGAAGG + Intronic
946414491 2:219532969-219532991 CAGAGACATGAAGAGGCTGATGG - Intronic
946612873 2:221478176-221478198 CAGAGATATTAAGCTACTGCTGG + Intronic
948115173 2:235490116-235490138 GAGAGATTGGAAGATGCCGCTGG - Intergenic
1169144829 20:3245263-3245285 CAGAGATCTAAAGAGGCTGGAGG - Intergenic
1169464367 20:5824264-5824286 CAGAGATCTGAAGAAAGTGAGGG - Intronic
1170404967 20:16026260-16026282 CAGGGCTCTGCAGATCCTGCAGG + Intronic
1171331815 20:24346719-24346741 TCCAGATCTGAAGATGCTGCAGG - Intergenic
1172046437 20:32083996-32084018 CAGAGTGCTGAAGGTGCTTCGGG - Exonic
1173593037 20:44240321-44240343 CAGAGATATGAAGGTGGTGAGGG + Intergenic
1174317062 20:49712038-49712060 AAATGATCAGAAGATGCTGCTGG - Intronic
1174440956 20:50552886-50552908 CAGAGATCTGATGAAGGTGAGGG - Intronic
1175292981 20:57890668-57890690 CTGAGACCTGAGGATGCTGGAGG + Intergenic
1175671403 20:60906107-60906129 AAGAGAAATGATGATGCTGCTGG + Intergenic
1175786795 20:61717051-61717073 CAGGGATGGGAAGAAGCTGCTGG - Intronic
1179113642 21:38469190-38469212 CAGAGTTCTGAGGATGAGGCTGG - Intronic
1181150817 22:20882021-20882043 CAGAGATCTGAAGATGCTGCTGG + Intronic
1181986028 22:26800397-26800419 CACAGTTCTGCAGATGGTGCAGG - Intergenic
1183258703 22:36780098-36780120 CTGAGATCTGAAGATCATGAAGG - Intergenic
1183745186 22:39687893-39687915 CAGTGATCTGGAGAGGCTGCAGG + Exonic
1184769338 22:46588601-46588623 GAGCGATCTGAAGATGTTCCTGG + Intronic
1184921249 22:47607404-47607426 CAGAGAACTGCAGATCCTCCTGG + Intergenic
1185063675 22:48620248-48620270 CAGGGACCTGGAGACGCTGCAGG - Intronic
950303532 3:11901377-11901399 CAGGGAGGTGAAGGTGCTGCTGG + Intergenic
952830687 3:37562272-37562294 CAGATATCTGTAGGTGCTCCGGG - Intronic
953192244 3:40699076-40699098 CAGAAAGCTGAAGGTGCTGGAGG - Intergenic
954395234 3:50289970-50289992 CAGAGACCAGCAGAGGCTGCAGG + Exonic
955647924 3:61160485-61160507 CAGCCATCTTAACATGCTGCAGG - Intronic
955754437 3:62213696-62213718 CAGAGACCAGAACATGCTGTAGG - Intronic
956533304 3:70246113-70246135 CAGATATATGCAGATGCTTCTGG + Intergenic
960304161 3:116040816-116040838 CAGAGATTTGAGGCTGCAGCAGG - Intronic
962208651 3:133457276-133457298 CAGAGATATGAAGATGCTTCGGG - Intronic
963357980 3:144234120-144234142 CAGAGATCTCAGGCTGTTGCAGG + Intergenic
966785501 3:183619503-183619525 CAGGGAGCTGGGGATGCTGCTGG - Intergenic
968919029 4:3512989-3513011 CCGAGCTCTGGAGATCCTGCCGG + Exonic
969471991 4:7394475-7394497 CTGAGATCTGAAGGTTCAGCAGG + Intronic
970275205 4:14392178-14392200 CTGAGATCTGAAGAAGGAGCAGG - Intergenic
972168087 4:36311492-36311514 GTGAGATCTGAAGATACAGCAGG - Intronic
973056076 4:45659661-45659683 CTGGAATTTGAAGATGCTGCTGG + Intergenic
976990733 4:91361985-91362007 CAGATATCTGAAGAAACTGAGGG + Intronic
977916266 4:102597593-102597615 AGGAGACGTGAAGATGCTGCTGG + Exonic
979604591 4:122624404-122624426 CAGTGAACTGAGGATGCTGGTGG - Intergenic
980221351 4:129920056-129920078 AAGAGAGGTGAAGAAGCTGCAGG + Intergenic
980857754 4:138460404-138460426 GAGAGAGGTGAAGAAGCTGCAGG - Intergenic
981116467 4:140996526-140996548 CACAGAGGTGAAGAAGCTGCAGG - Intronic
982912426 4:161161193-161161215 CAGAGTTCTGAAGAATATGCAGG + Intergenic
984035493 4:174662706-174662728 CTGAGACCTGAAGAACCTGCTGG - Intronic
984947339 4:184980052-184980074 CAGAGATCTGCAGGAGCAGCAGG - Intergenic
985327079 4:188783003-188783025 AAGAGTTCTGAGGATGCTGTGGG - Intergenic
985640170 5:1059852-1059874 CAGAAATCTGTGCATGCTGCGGG + Intronic
985802293 5:2012608-2012630 GAAGGGTCTGAAGATGCTGCCGG + Intergenic
989592394 5:43123658-43123680 CAGACTGCTGGAGATGCTGCAGG + Intronic
989757012 5:44967704-44967726 CAGAGATGAGAAGTGGCTGCTGG + Intergenic
990524146 5:56608173-56608195 CAGAGACTTGAATATGCAGCTGG + Intergenic
990603545 5:57384960-57384982 CAGAGATCGAGAGATGCTGTTGG + Intergenic
993143215 5:84060405-84060427 GAGCGTTCTGAAGATGCTGGAGG + Exonic
993591007 5:89794992-89795014 CAGAGCTCTCAAGATGGTGGTGG - Intergenic
995819866 5:116218033-116218055 CAGAAAGCTGAAGGTGCTGGAGG - Intronic
995839144 5:116426776-116426798 GTGAGAGCTGAAGAAGCTGCAGG + Intergenic
996415437 5:123205414-123205436 CACAGATCTGAAAATGCTAGTGG + Intergenic
997460000 5:134045528-134045550 GACAGATTTGGAGATGCTGCTGG - Intergenic
998122068 5:139587000-139587022 CAGAGCTCTCAAGATGGTGGTGG + Intronic
998213670 5:140220899-140220921 AAGAGAACTGAAGCTGCTGCTGG + Intronic
1000621825 5:163494774-163494796 CAGAGTTCTGAAAAAGATGCTGG + Intergenic
1000951557 5:167489444-167489466 CAGAGGTCTGAAGATAGTGTGGG - Intronic
1001210105 5:169803089-169803111 CAAAGAGCTGAAGGAGCTGCTGG + Exonic
1001315465 5:170638381-170638403 CTGAGAACTGGGGATGCTGCAGG - Intronic
1001913325 5:175539106-175539128 CAGAGATGTGAAAGTGGTGCAGG - Intergenic
1002147656 5:177197930-177197952 CAGAGAAGGGAGGATGCTGCAGG + Intronic
1002854524 6:1025630-1025652 CAGAAATCAGGAAATGCTGCAGG - Intergenic
1002907479 6:1462515-1462537 CTGAAATCTGAATATGCTTCAGG + Intergenic
1003005078 6:2373663-2373685 CAGCTATGTGAAGATGCAGCAGG + Intergenic
1004483348 6:16041647-16041669 CAGAGGATTGAAGTTGCTGCTGG - Intergenic
1005816715 6:29558944-29558966 CAGAGCTCTCAAGATGGTGGTGG - Intronic
1005947966 6:30608796-30608818 CAGTGAGCGGTAGATGCTGCAGG + Exonic
1007881043 6:45167084-45167106 CAGAGATCTTAATGTGCTCCTGG - Intronic
1009762663 6:68027951-68027973 CAAAGATCTGAAGATACTGAGGG - Intergenic
1010512011 6:76731206-76731228 AAGAGATTCGAAGATCCTGCTGG + Intergenic
1010787594 6:80022413-80022435 CAGTGATTTGAAGATGCAGCAGG - Exonic
1010966453 6:82214590-82214612 CAGAAAGATGAAGATTCTGCAGG - Exonic
1011013266 6:82726116-82726138 CAGAGATCTGAATATAGTGAGGG + Intergenic
1011330931 6:86205902-86205924 TAGAGATGTGAGGATTCTGCCGG + Intergenic
1012352787 6:98273674-98273696 CAGAGACCTGCAGATGCTACGGG - Intergenic
1013823797 6:114186506-114186528 GAGAGACGTGAAGAAGCTGCAGG + Intronic
1016030508 6:139332730-139332752 TAGAGTTATGAAGAAGCTGCAGG - Intergenic
1017224363 6:152003033-152003055 AAGAGTTCTGAAGAAGCTGATGG - Intronic
1017614752 6:156233296-156233318 CACAAATCTGAAGGTGCTGCAGG + Intergenic
1017814392 6:158006152-158006174 CAGAGAAATGGAGAGGCTGCTGG - Intronic
1018475653 6:164138265-164138287 CAGAGATTTCACGATGCTGATGG + Intergenic
1018867600 6:167758379-167758401 CAGGGGTCTGAAGGAGCTGCCGG - Intergenic
1020050135 7:5076066-5076088 CAAGGATCTGAAAAGGCTGCAGG - Intergenic
1021508416 7:21410020-21410042 CAGAGATCTGAAGGAGATGAGGG - Intergenic
1024478334 7:49838113-49838135 CAGAGGACTGAAGATCCTGAAGG + Intronic
1025025558 7:55513615-55513637 AAGACCTCTAAAGATGCTGCAGG + Intronic
1026560829 7:71447055-71447077 CAGAGAACTGAAGATTTGGCTGG - Intronic
1028510019 7:91614239-91614261 CAGAAGTCTGAATATGGTGCAGG - Intergenic
1033005376 7:137555576-137555598 CAGAGTTCTGAAAATCATGCAGG + Intronic
1033490439 7:141838094-141838116 CAGAAATCTGAAAGTGATGCTGG - Exonic
1033622225 7:143071959-143071981 CAGAGATTTGAAGCTCCAGCGGG - Intergenic
1033935659 7:146582481-146582503 CATAGATATTAAGATGCTACCGG + Intronic
1035361858 7:158318567-158318589 CAGGGATCGGAAGAGGCCGCCGG - Intronic
1036294843 8:7527447-7527469 CAGAGGGCTCCAGATGCTGCAGG + Intergenic
1036327720 8:7793544-7793566 CAGAGGGCTCCAGATGCTGCAGG - Intergenic
1039416045 8:37394751-37394773 GAGAGCACTCAAGATGCTGCGGG + Intergenic
1039880658 8:41623481-41623503 CAGAGAAGTGAAGGTGCAGCAGG - Exonic
1042358974 8:67860831-67860853 CAGAGTGCTGAAAATGCTACTGG + Intergenic
1042393006 8:68257408-68257430 CAGCAATCTGAAGAGGCTGGTGG + Intergenic
1043626586 8:82268379-82268401 CAAACATCTGATGATTCTGCTGG + Intergenic
1044212082 8:89561910-89561932 CGGAGATCTGAAGAAACTGAGGG - Intergenic
1044708665 8:95033709-95033731 CAGAGATCTGAAGGAGGTGAGGG + Intronic
1046060508 8:109134113-109134135 CAGAGACCAGAAGAGGCTCCTGG + Intergenic
1048013554 8:130477987-130478009 CTGAGCTCAGAAGATGGTGCTGG + Intergenic
1048813172 8:138306919-138306941 CAGAGATTAGCAAATGCTGCTGG + Intronic
1049564059 8:143328764-143328786 CAGAGCCAGGAAGATGCTGCGGG + Intronic
1049893948 9:96623-96645 CAGAGATTTGAAGACACTGAAGG + Intergenic
1050123893 9:2336462-2336484 AGGAGATCTGAATATGCTGTAGG + Intergenic
1050607993 9:7321157-7321179 CAAACAGCTGAAGATGATGCAGG - Intergenic
1052675276 9:31614300-31614322 CAAAGATGTGAAGATGCCTCTGG + Intergenic
1052970215 9:34372769-34372791 CAAAGACCTGAAGCCGCTGCTGG - Exonic
1054693205 9:68334690-68334712 CAGAGATTTGAAGACACTGAAGG - Intronic
1054734482 9:68736677-68736699 GTGAGGTTTGAAGATGCTGCTGG - Intronic
1060042870 9:120315910-120315932 CAGAGATCTGAAGTTGGCACAGG + Intergenic
1060893889 9:127205239-127205261 CTGGGACCTGAAGAGGCTGCAGG - Intronic
1061024788 9:128041491-128041513 CAGAGGCCTGAACTTGCTGCTGG + Intergenic
1061747298 9:132749852-132749874 CAGAGAACAGACGCTGCTGCAGG + Intronic
1061750937 9:132776587-132776609 CAGAGCTCTGAGAGTGCTGCGGG + Intronic
1186254478 X:7703565-7703587 CAGAGATCCCAAGATGGTGGCGG + Intergenic
1189386110 X:40538265-40538287 CACAGTTGAGAAGATGCTGCTGG - Intergenic
1189509859 X:41652070-41652092 CAAAGACCTGAAGATGGTGAGGG + Intronic
1189757434 X:44285259-44285281 CAGAGATCTGAAGATGACAGAGG + Intronic
1189987213 X:46564505-46564527 CAGAGATCTGAAGGTGGAGAAGG - Intergenic
1190180647 X:48189023-48189045 GAGAGAGGTGAAGAAGCTGCAGG + Intronic
1190183570 X:48215594-48215616 GAGAGAGGTGAAGAAGCTGCAGG - Intronic
1190193694 X:48298526-48298548 GAGAGAGGTGAAGAAGCTGCAGG + Intergenic
1190199561 X:48348880-48348902 GAGAGAGGTGAAGAAGCTGCAGG + Intronic
1190204336 X:48390570-48390592 GAGAGAGCTGAAGAAGCTGCAGG - Intronic
1190206200 X:48404833-48404855 GAGAGAGCTGAAGAAGCTGCAGG + Intronic
1190509783 X:51163320-51163342 GAGAGAGTTGAAGATGCTGAGGG + Intergenic
1190660213 X:52647156-52647178 GAGAGAGGTGAAGAAGCTGCAGG + Intronic
1190663370 X:52675657-52675679 GAGAGAGGTGAAGAAGCTGCAGG - Intronic
1190666334 X:52699325-52699347 GAGAGAGGTGAAGAAGCTGCAGG + Intronic
1190673084 X:52759085-52759107 GAGAGAGGTGAAGAAGCTGCAGG - Intronic
1190676053 X:52782825-52782847 GAGAGAGGTGAAGAAGCTGCAGG + Intronic
1191771878 X:64769405-64769427 CTTAGATCTGCATATGCTGCAGG + Intergenic
1192564494 X:72152394-72152416 CAGAGAACTGATGAGGGTGCTGG - Intergenic
1196558146 X:117115787-117115809 TAGAGATGTGAAGATTCTGGCGG - Intergenic
1199082821 X:143595416-143595438 CAGAGTTCTGGAGGGGCTGCTGG + Intergenic
1200936873 Y:8745985-8746007 AAGATATCTGAAGATGATGGAGG + Intergenic
1202050457 Y:20775390-20775412 CAAAGATCTGCAGGTGCTGGGGG - Intronic