ID: 1181152070

View in Genome Browser
Species Human (GRCh38)
Location 22:20891635-20891657
Sequence ATCTTCAGCTCTGATGAATG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181152069_1181152070 12 Left 1181152069 22:20891600-20891622 CCTGTAGAATTTTAAAGTTACAA No data
Right 1181152070 22:20891635-20891657 ATCTTCAGCTCTGATGAATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181152070 Original CRISPR ATCTTCAGCTCTGATGAATG CGG Intergenic
No off target data available for this crispr