ID: 1181161164

View in Genome Browser
Species Human (GRCh38)
Location 22:20960748-20960770
Sequence GTGTGGGCAAGGAGGTAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181161164_1181161171 25 Left 1181161164 22:20960748-20960770 CCATCTTACCTCCTTGCCCACAC No data
Right 1181161171 22:20960796-20960818 TCCTCTCCTATGAACACCTACGG No data
1181161164_1181161173 26 Left 1181161164 22:20960748-20960770 CCATCTTACCTCCTTGCCCACAC No data
Right 1181161173 22:20960797-20960819 CCTCTCCTATGAACACCTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181161164 Original CRISPR GTGTGGGCAAGGAGGTAAGA TGG (reversed) Intergenic
No off target data available for this crispr