ID: 1181161317

View in Genome Browser
Species Human (GRCh38)
Location 22:20961641-20961663
Sequence AGCACCCACTGGATTCTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181161317_1181161325 15 Left 1181161317 22:20961641-20961663 CCCCAAAGAATCCAGTGGGTGCT No data
Right 1181161325 22:20961679-20961701 AGGCCTGTGTAGACAGACCTGGG No data
1181161317_1181161327 30 Left 1181161317 22:20961641-20961663 CCCCAAAGAATCCAGTGGGTGCT No data
Right 1181161327 22:20961694-20961716 GACCTGGGCCGAGAAGAAGCTGG No data
1181161317_1181161323 -5 Left 1181161317 22:20961641-20961663 CCCCAAAGAATCCAGTGGGTGCT No data
Right 1181161323 22:20961659-20961681 GTGCTGGGCATACAGTCGTCAGG No data
1181161317_1181161324 14 Left 1181161317 22:20961641-20961663 CCCCAAAGAATCCAGTGGGTGCT No data
Right 1181161324 22:20961678-20961700 CAGGCCTGTGTAGACAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181161317 Original CRISPR AGCACCCACTGGATTCTTTG GGG (reversed) Intergenic
No off target data available for this crispr