ID: 1181165850

View in Genome Browser
Species Human (GRCh38)
Location 22:20982568-20982590
Sequence CCCATGAAGCCCACCGTACC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 61}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181165850_1181165865 27 Left 1181165850 22:20982568-20982590 CCCGGTACGGTGGGCTTCATGGG 0: 1
1: 0
2: 3
3: 6
4: 61
Right 1181165865 22:20982618-20982640 GAGGGTCCCAGGGCGGGTCCAGG 0: 1
1: 0
2: 1
3: 47
4: 320
1181165850_1181165855 -9 Left 1181165850 22:20982568-20982590 CCCGGTACGGTGGGCTTCATGGG 0: 1
1: 0
2: 3
3: 6
4: 61
Right 1181165855 22:20982582-20982604 CTTCATGGGGTCCTGAGGACAGG 0: 1
1: 0
2: 2
3: 36
4: 248
1181165850_1181165867 29 Left 1181165850 22:20982568-20982590 CCCGGTACGGTGGGCTTCATGGG 0: 1
1: 0
2: 3
3: 6
4: 61
Right 1181165867 22:20982620-20982642 GGGTCCCAGGGCGGGTCCAGGGG 0: 1
1: 0
2: 4
3: 38
4: 340
1181165850_1181165860 9 Left 1181165850 22:20982568-20982590 CCCGGTACGGTGGGCTTCATGGG 0: 1
1: 0
2: 3
3: 6
4: 61
Right 1181165860 22:20982600-20982622 ACAGGAAGGGCGATCTGCGAGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1181165850_1181165861 16 Left 1181165850 22:20982568-20982590 CCCGGTACGGTGGGCTTCATGGG 0: 1
1: 0
2: 3
3: 6
4: 61
Right 1181165861 22:20982607-20982629 GGGCGATCTGCGAGGGTCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 84
1181165850_1181165866 28 Left 1181165850 22:20982568-20982590 CCCGGTACGGTGGGCTTCATGGG 0: 1
1: 0
2: 3
3: 6
4: 61
Right 1181165866 22:20982619-20982641 AGGGTCCCAGGGCGGGTCCAGGG 0: 1
1: 0
2: 3
3: 28
4: 244
1181165850_1181165864 21 Left 1181165850 22:20982568-20982590 CCCGGTACGGTGGGCTTCATGGG 0: 1
1: 0
2: 3
3: 6
4: 61
Right 1181165864 22:20982612-20982634 ATCTGCGAGGGTCCCAGGGCGGG 0: 1
1: 1
2: 2
3: 18
4: 155
1181165850_1181165862 17 Left 1181165850 22:20982568-20982590 CCCGGTACGGTGGGCTTCATGGG 0: 1
1: 0
2: 3
3: 6
4: 61
Right 1181165862 22:20982608-20982630 GGCGATCTGCGAGGGTCCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 59
1181165850_1181165856 -5 Left 1181165850 22:20982568-20982590 CCCGGTACGGTGGGCTTCATGGG 0: 1
1: 0
2: 3
3: 6
4: 61
Right 1181165856 22:20982586-20982608 ATGGGGTCCTGAGGACAGGAAGG 0: 1
1: 0
2: 3
3: 39
4: 427
1181165850_1181165863 20 Left 1181165850 22:20982568-20982590 CCCGGTACGGTGGGCTTCATGGG 0: 1
1: 0
2: 3
3: 6
4: 61
Right 1181165863 22:20982611-20982633 GATCTGCGAGGGTCCCAGGGCGG 0: 1
1: 0
2: 2
3: 19
4: 233
1181165850_1181165857 -4 Left 1181165850 22:20982568-20982590 CCCGGTACGGTGGGCTTCATGGG 0: 1
1: 0
2: 3
3: 6
4: 61
Right 1181165857 22:20982587-20982609 TGGGGTCCTGAGGACAGGAAGGG 0: 1
1: 0
2: 6
3: 62
4: 492
1181165850_1181165859 8 Left 1181165850 22:20982568-20982590 CCCGGTACGGTGGGCTTCATGGG 0: 1
1: 0
2: 3
3: 6
4: 61
Right 1181165859 22:20982599-20982621 GACAGGAAGGGCGATCTGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181165850 Original CRISPR CCCATGAAGCCCACCGTACC GGG (reversed) Exonic
904312806 1:29640228-29640250 CCCATGAAGCCCATCTCACCAGG - Intergenic
905363753 1:37437600-37437622 GCCATGCAGCCCACGGTCCCAGG + Intergenic
915514415 1:156404420-156404442 CCCAGGAAGCCCACTGTACCTGG - Exonic
916715479 1:167443445-167443467 CCCATGAAGGCCACCAAAGCTGG + Intronic
921519428 1:216141334-216141356 CCCAGGGAGCCCACAGCACCTGG - Intronic
922193075 1:223336919-223336941 CCCTTGAAGCCCATGGAACCTGG + Intronic
1069807306 10:71133991-71134013 CCCAGGCACCCCACAGTACCAGG + Intergenic
1071138118 10:82475485-82475507 CCCATGAAGCCATCTGTTCCTGG - Intronic
1075031536 10:119027906-119027928 CCCATGAAGCCCACCCTGCCAGG + Intergenic
1075353209 10:121744940-121744962 GCCATGAAGTCCAACGTTCCAGG - Intronic
1080607672 11:33877143-33877165 CCCATGGAGGCCACCATACCAGG - Intronic
1081877420 11:46418849-46418871 CCCATAAAGCCCACCATACCAGG + Intronic
1097061065 12:56284362-56284384 GGCATGAGCCCCACCGTACCTGG - Intronic
1098245394 12:68512058-68512080 CCCATGAAGCCAGCCTTACATGG + Intergenic
1101167464 12:102052859-102052881 CCCATGTAGCCCAAGTTACCAGG + Intronic
1103293801 12:119868873-119868895 ACCAAGAAGCCCAACTTACCTGG + Intronic
1104971208 12:132531470-132531492 CCCATGCAGCCCACCACACGGGG - Intronic
1115120301 14:29928879-29928901 CCCATGAAGCCCACCCTGGTTGG - Intronic
1116999269 14:51355747-51355769 TCCATGGAGCCCATCATACCAGG + Intergenic
1123069722 14:105636546-105636568 TCCACGAAGCCCACCCTTCCAGG - Intergenic
1123088804 14:105732265-105732287 TCCACGAAGCCCACCCTTCCAGG - Intergenic
1123094742 14:105761588-105761610 TCCACGAAGCCCACCCTGCCAGG - Intergenic
1131153148 15:90059466-90059488 CCCGTGATGCGCACCATACCCGG - Intronic
1132646057 16:999824-999846 CCCAGGGAGCCCACAGTGCCCGG - Intergenic
1133315853 16:4883621-4883643 CGGAGGAAGCCCACCGTGCCGGG - Exonic
1134777838 16:16868312-16868334 CACATGCAGCCCACCCTATCTGG + Intergenic
1138130138 16:54472350-54472372 CCCATGAAGCCAGCCCCACCTGG - Intergenic
1149010912 17:51855232-51855254 CCCACCAAGCCCACAGTGCCTGG + Intronic
1157816333 18:50731907-50731929 CCCATGAAGGCCACTGTATTTGG + Intergenic
1157932912 18:51842758-51842780 CCTGGGAAGCCCACCGTCCCAGG - Intergenic
1158573179 18:58613804-58613826 CCCATGAGGCCCACCTTGCTTGG + Intronic
1165823763 19:38693829-38693851 CCCCTGAAGCCCGCCTTAGCTGG + Intronic
925298729 2:2795177-2795199 CCCTTGAGCCCCACAGTACCTGG + Intergenic
946299813 2:218815803-218815825 CCCATGAAGCCAGCAGTAACTGG + Intergenic
1172523331 20:35583059-35583081 CCCTTGATGCCCACCTTCCCTGG - Intergenic
1177371351 21:20207970-20207992 CACATGACGGCTACCGTACCTGG - Intergenic
1181165850 22:20982568-20982590 CCCATGAAGCCCACCGTACCGGG - Exonic
955096342 3:55801851-55801873 CCCATGAAGCCTGCCCTGCCTGG + Intronic
967122084 3:186391170-186391192 CCCATAAAGGCCACCTTACTTGG + Intergenic
968299303 3:197601022-197601044 CACATGAAGCCCAGGGTACCTGG + Intergenic
968654981 4:1774575-1774597 CTCAAGAACCCCACCCTACCTGG + Intergenic
970488076 4:16544379-16544401 CCCATGAAGCCCACTTGGCCTGG - Intronic
971256725 4:25021288-25021310 CCCATGAAGCCCAAGGGACAGGG - Intronic
972149520 4:36071497-36071519 ACCATGAAGCCTTCCCTACCTGG + Intronic
985574877 5:669412-669434 CCCAGGCAGCCCACAGTGCCTGG + Intronic
992198739 5:74364066-74364088 CCCATGAAGTCCACATTAGCAGG - Intergenic
999852918 5:155562313-155562335 CCCATGAAGCCCACACAACAAGG + Intergenic
1003497713 6:6678796-6678818 CCCCTGGAGCCCACCATTCCAGG + Intergenic
1006431033 6:33995964-33995986 CCCATGAGGCCCTCTGTGCCAGG - Intergenic
1007180674 6:39927170-39927192 CCCCTGAAGCCCACCTGGCCTGG + Intronic
1009469973 6:64020511-64020533 CCCATGAAGCCCTTGGTATCAGG - Intronic
1017842225 6:158231875-158231897 CCCAAGATGCCCACAGTGCCGGG - Intergenic
1018463792 6:164023881-164023903 CAAATGAAGCCCACAGTACCAGG - Intergenic
1019637861 7:2086037-2086059 CCCAGGAATCCCACCCTGCCCGG + Intronic
1019707285 7:2502725-2502747 TCCCTGAAGCCCACCCTGCCAGG + Intergenic
1023939357 7:44760061-44760083 CCCTAGAAGCCCACCATACACGG - Intronic
1026952028 7:74354001-74354023 CAGAAGAAGCCCACCATACCTGG - Exonic
1027379336 7:77589161-77589183 CCCATGTAATCCACCGCACCAGG + Intronic
1033633436 7:143184442-143184464 CCCAAGAAGACCACAGGACCTGG + Intergenic
1038447713 8:27615363-27615385 GCCATGAAGCCCACCCTGCTTGG - Intergenic
1040708324 8:50156159-50156181 CTAATGAAGCCAACTGTACCTGG - Intronic
1041297973 8:56380179-56380201 CCCATGAAGCCCTCTGGATCTGG + Intergenic
1044299473 8:90567046-90567068 CCCATGAAGACCCTGGTACCTGG + Intergenic
1048440030 8:134452996-134453018 CCCATGTAGCCCACTCTCCCTGG - Intergenic
1059522122 9:114952888-114952910 CCCATGAATCCCACTGCAACAGG + Intergenic
1060240528 9:121898639-121898661 CCCAGGGAGCCCACCGTGCCTGG - Intronic
1060549081 9:124476760-124476782 CCCCCTAAGCCCCCCGTACCAGG + Intronic
1061154177 9:128847126-128847148 CCCAGGAACCCCACCGCGCCTGG + Intronic
1061295837 9:129676214-129676236 CCCCTGATTCCCACCGTCCCAGG - Intronic
1061714403 9:132509860-132509882 CCCAGGAAGCCCAGCCTCCCTGG + Intronic
1198967694 X:142244773-142244795 CCCATGAGGCCCAACGCACCAGG + Intergenic