ID: 1181167158

View in Genome Browser
Species Human (GRCh38)
Location 22:20989875-20989897
Sequence TCTCCTCCCTGGTGACCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 334}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181167149_1181167158 11 Left 1181167149 22:20989841-20989863 CCCTTGCAAAGCCCAGCCTCGAC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1181167158 22:20989875-20989897 TCTCCTCCCTGGTGACCTGCGGG 0: 1
1: 0
2: 3
3: 25
4: 334
1181167153_1181167158 -5 Left 1181167153 22:20989857-20989879 CCTCGACCTGAGCCTCGCTCTCC 0: 1
1: 0
2: 0
3: 22
4: 188
Right 1181167158 22:20989875-20989897 TCTCCTCCCTGGTGACCTGCGGG 0: 1
1: 0
2: 3
3: 25
4: 334
1181167152_1181167158 -1 Left 1181167152 22:20989853-20989875 CCAGCCTCGACCTGAGCCTCGCT 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1181167158 22:20989875-20989897 TCTCCTCCCTGGTGACCTGCGGG 0: 1
1: 0
2: 3
3: 25
4: 334
1181167150_1181167158 10 Left 1181167150 22:20989842-20989864 CCTTGCAAAGCCCAGCCTCGACC 0: 1
1: 0
2: 0
3: 13
4: 205
Right 1181167158 22:20989875-20989897 TCTCCTCCCTGGTGACCTGCGGG 0: 1
1: 0
2: 3
3: 25
4: 334
1181167148_1181167158 12 Left 1181167148 22:20989840-20989862 CCCCTTGCAAAGCCCAGCCTCGA 0: 1
1: 0
2: 2
3: 20
4: 136
Right 1181167158 22:20989875-20989897 TCTCCTCCCTGGTGACCTGCGGG 0: 1
1: 0
2: 3
3: 25
4: 334
1181167151_1181167158 0 Left 1181167151 22:20989852-20989874 CCCAGCCTCGACCTGAGCCTCGC 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1181167158 22:20989875-20989897 TCTCCTCCCTGGTGACCTGCGGG 0: 1
1: 0
2: 3
3: 25
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181167158 Original CRISPR TCTCCTCCCTGGTGACCTGC GGG Intronic
900243322 1:1626925-1626947 CCTCCTGCCTGGTGGCCTACCGG + Exonic
900618406 1:3575989-3576011 TCTCCTCCCTGCTGAACAGAAGG + Intronic
900680480 1:3913545-3913567 TCCCCTTCCTGGAGACCTGGCGG + Intergenic
901175997 1:7299626-7299648 TCTCCTCCCTGGCCACATTCAGG + Intronic
902700289 1:18167697-18167719 CCTCCACCCTCGTGATCTGCTGG + Intronic
903065358 1:20696581-20696603 GCTACTCCCTGGTGACCACCAGG + Intronic
904092551 1:27955549-27955571 TCTCCTCCCTGAAGGCCTCCCGG - Intronic
904095496 1:27973679-27973701 TCTCCTAGCTGGTGAACTGTGGG - Exonic
904353523 1:29924153-29924175 TCTCCTCCCTGGCTGCCTGCTGG + Intergenic
904452042 1:30619546-30619568 TCTCCTCCTGGGTGAGCTGTTGG + Intergenic
906323101 1:44828656-44828678 GCCCCTCCCTTGTGACCTGAGGG - Intronic
906325607 1:44843433-44843455 CCTCCTCCCTGGGGCCCCGCGGG - Intergenic
907047027 1:51305646-51305668 TCTCTGCCCTGGAGAGCTGCTGG - Intronic
907909918 1:58816482-58816504 GCTCCTCCCTGCGGTCCTGCCGG + Intergenic
912606423 1:110994123-110994145 TCCCCTCCCTTATGATCTGCTGG - Intergenic
912732486 1:112121020-112121042 TCACCTCCCTGGTTAGCTGTGGG - Intergenic
912968733 1:114260525-114260547 TCCCCACCTGGGTGACCTGCAGG + Intergenic
917930883 1:179821736-179821758 CCTCCTCCCTCGTGTCCTGCCGG + Intergenic
918098878 1:181356594-181356616 TCTTCTCCCTGAAGGCCTGCTGG - Intergenic
919220626 1:194624707-194624729 TTTCCCCTCTGGTGCCCTGCTGG + Intergenic
919921092 1:202166898-202166920 TTTCCTCCCTGGAGAGCTGAGGG + Intergenic
921052119 1:211518186-211518208 TCTTCTCACTGGGCACCTGCTGG + Intergenic
922532624 1:226356062-226356084 TCTTCTCCCTGATGACAAGCGGG - Intergenic
922779699 1:228241527-228241549 GCTCATCCTTGGTGACCTGGTGG - Intronic
924474282 1:244369603-244369625 TCTGGTCCCTGGTGAAGTGCAGG + Intronic
924555053 1:245111284-245111306 TCTGATACCCGGTGACCTGCAGG + Intronic
1063163080 10:3433975-3433997 TCTCCGCCCTGATGGCCTGACGG + Intergenic
1064534644 10:16346169-16346191 TTTCTTCCCTGGTAACCTGTGGG - Intergenic
1065057230 10:21858761-21858783 TTTCCTCCCTGGTGACCTAGTGG - Intronic
1066393238 10:34995673-34995695 TCTGCTCCCTGAAGTCCTGCTGG - Intergenic
1067289616 10:44931680-44931702 TGTCCATCCTGGTGACCAGCAGG + Intronic
1069628929 10:69885860-69885882 TCTCCTCCCTCGTGCCCTTTTGG + Intronic
1070506766 10:77120280-77120302 TCCCTTTCCTGATGACCTGCCGG - Intronic
1070922253 10:80195339-80195361 TCTCCTCCAGAGTGAGCTGCAGG - Intronic
1071087139 10:81876470-81876492 CCTCCTCACTGCAGACCTGCTGG + Intronic
1071569415 10:86688481-86688503 TCTGCTCCCTGGTGGCCTAGAGG - Intronic
1073009946 10:100351257-100351279 TCACCTTCCTGGAGGCCTGCAGG - Intronic
1073770244 10:106727905-106727927 TCTCCTCACTCGTTGCCTGCAGG - Intronic
1074100762 10:110353404-110353426 TCTGCTCCCAGGTGAGCGGCAGG - Intergenic
1074469450 10:113714185-113714207 CGTCCTGCCTGGTGACCAGCAGG - Intronic
1075316144 10:121455171-121455193 TCTCCTTCCTGGTGGCCTTGTGG + Intergenic
1076367686 10:129932775-129932797 CCTCCTGCCTGGTCACATGCCGG - Intronic
1076607963 10:131701613-131701635 TCTCCTCACTGGTGTCCTGATGG - Intergenic
1076691062 10:132224092-132224114 GCTCCTCTGTGGTGACCGGCAGG + Intronic
1077453567 11:2664920-2664942 TCACCTCTCTGGGGCCCTGCGGG - Intronic
1077600329 11:3570156-3570178 TCTGCACCCTGGTGTCCTGAGGG - Intergenic
1080225110 11:29950988-29951010 TATCCTGCCTGATGACCTTCAGG - Intergenic
1080655369 11:34253782-34253804 TCTCCTCCTTCATTACCTGCTGG + Intronic
1081285038 11:41257650-41257672 TTTGCCCCCTGGTGACCTGTTGG - Intronic
1081686348 11:45045920-45045942 TCTGCTCCCTGGTGGCTTGTTGG + Intergenic
1081915644 11:46728547-46728569 TCCCCTCCCTGGTGGCCTGCAGG + Intronic
1083541859 11:63516829-63516851 TCTGCTCCCTGGAGACATTCAGG + Intergenic
1084152867 11:67299363-67299385 TCTCCTCGTTGGTGACTTCCTGG + Intronic
1084734616 11:71096476-71096498 TCTCTTCCCTGGTGGCATCCAGG + Intronic
1084816519 11:71650527-71650549 TCTGCACCCTGGTGTCCTGGGGG + Intergenic
1084942985 11:72623857-72623879 TCTCCTGCCTGGGCAGCTGCAGG + Intronic
1085197400 11:74680884-74680906 TCTCCTCCATGGTGGCATCCGGG + Intergenic
1085764358 11:79270129-79270151 CCTCCTGCCTGGCCACCTGCAGG + Intronic
1086799471 11:91153393-91153415 TCTACTCCCTTTTGACTTGCAGG - Intergenic
1088510371 11:110567289-110567311 TCTCCTCACTGGTCACCAGATGG - Intergenic
1088945846 11:114511831-114511853 TCTCCTGCCATGTGACATGCTGG + Intergenic
1089012323 11:115141372-115141394 TCTTCTCCCCGGTAGCCTGCAGG + Intergenic
1089296171 11:117469683-117469705 TCTCCTCCCTGGTTCTCTGATGG - Intronic
1090489723 11:127148065-127148087 AGTCTTCCCTGGTCACCTGCAGG - Intergenic
1090739137 11:129641332-129641354 GCTACTCCCTGTTGACCTCCTGG + Intergenic
1091150436 11:133323649-133323671 TCTCCTGCCTGGTGGCCTAGTGG - Intronic
1091908944 12:4213185-4213207 CCTCCTCTCTGGTGGCCTGTGGG - Intergenic
1092085828 12:5758731-5758753 TCTCCTCACTACTGACCTGATGG + Intronic
1092426474 12:8379507-8379529 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1093700172 12:22211330-22211352 TCTCCTCCCTGGAGACTGGGGGG + Intronic
1096002389 12:48140661-48140683 CCTCCTCCCTGTTCCCCTGCTGG + Intronic
1097347138 12:58505959-58505981 CCTCCACCCTGGTGACCTTGGGG + Intergenic
1097925110 12:65118659-65118681 TCTCCTCCCTAATTCCCTGCAGG + Intronic
1100587022 12:95989856-95989878 TATCATCCCTGATGAACTGCTGG - Intronic
1101596610 12:106171924-106171946 TCTCCTCCCTTCTGACCCCCAGG - Intergenic
1101838390 12:108310886-108310908 GTGCCTCCCTGGTGAGCTGCAGG - Intronic
1102040300 12:109796573-109796595 TCTCCTCCCTGGACACGTGTGGG - Exonic
1102591136 12:113957747-113957769 CCTCCTCCCTCATCACCTGCGGG + Intronic
1103341930 12:120225340-120225362 TCAGCTCCCCGGTAACCTGCTGG + Intronic
1103573550 12:121860225-121860247 TCTCCTCCATGGGAACCTTCTGG - Intronic
1104844033 12:131838039-131838061 TCTCTTCCCTGGGCAGCTGCCGG - Intronic
1104950794 12:132439019-132439041 TGTCCTGCCTGGTGGCCTCCGGG + Intergenic
1104990290 12:132620663-132620685 CCTCCTCCCTCCTGACCAGCTGG + Intronic
1106049301 13:26175472-26175494 TCTCCTCTCAGATGACCTACTGG + Intronic
1106346550 13:28885291-28885313 ACTCCTCCCTGCTGACCTCTTGG - Intronic
1106851302 13:33795633-33795655 TCAGGTCCCTGGTGCCCTGCTGG - Intergenic
1107063740 13:36189379-36189401 TCTTCCCCCTTGTGACCTGATGG + Intronic
1107978612 13:45713763-45713785 TCTCCTCCCGGAGGAGCTGCAGG - Exonic
1108467502 13:50731497-50731519 TCTCCTCCCTGGGAATCTGTTGG + Intronic
1108679001 13:52763385-52763407 TTTCTTCCCTGGAGACCTGGTGG - Intergenic
1108757453 13:53521243-53521265 TGCCTTCCCTGGTGACCTGAAGG - Intergenic
1113938102 13:114005774-114005796 TCTCCCCCCTCCTGCCCTGCCGG + Intronic
1113938140 13:114005884-114005906 TCTCCCCCCTCCTGCCCTGCCGG + Intronic
1113938189 13:114006032-114006054 TCTCCCCCCTCCTGCCCTGCCGG + Intronic
1113938284 13:114006326-114006348 TCTCCCCCCTCCTGCCCTGCCGG + Intronic
1113938345 13:114006512-114006534 TCTCCCCCCTCCTGCCCTGCCGG + Intronic
1113938405 13:114006698-114006720 TCTCCCCCCTCCTGCCCTGCCGG + Intronic
1113938617 13:114007345-114007367 TCTCCCCCCTCCTGCCCTGCCGG + Intronic
1115425117 14:33249588-33249610 CCTTCTTCCTGGGGACCTGCAGG + Intronic
1116028080 14:39537906-39537928 TTTCCTCCTTGGAGAACTGCTGG - Intergenic
1116924025 14:50614665-50614687 GCTCCTCCTTGGTGAACTGTGGG + Intronic
1118437718 14:65786753-65786775 TCTCACCCCTGCTGACATGCTGG - Intergenic
1119751635 14:77082739-77082761 CCTCCACTTTGGTGACCTGCTGG + Intergenic
1121315588 14:92959281-92959303 GCTCCTTCCTGGGGCCCTGCGGG - Intronic
1121637530 14:95463750-95463772 GCTCCTCTCTGGGGCCCTGCGGG + Intronic
1122296584 14:100709398-100709420 CCTCCTCCCTGGGGCCCCGCCGG + Intergenic
1122928841 14:104924022-104924044 CCTCCTGACTGGTGTCCTGCAGG + Intergenic
1123990472 15:25679737-25679759 TCTGCTCCCTGGAGGCCAGCGGG - Exonic
1124781948 15:32644201-32644223 TCTCCTCACTGCTGATCTTCAGG + Intronic
1128572185 15:68741794-68741816 TTTCCTCCCTGGTGGTCAGCTGG - Intergenic
1128766742 15:70255711-70255733 TGTCCTCCCTGGGCTCCTGCAGG - Intergenic
1129466324 15:75726134-75726156 GCTCCTCCATGGGGACCTGCGGG - Exonic
1129908262 15:79205173-79205195 TCTCCTCCCTGGTCTCCATCCGG - Intergenic
1129940783 15:79495165-79495187 CCTCCTGCCTGGTCACCTTCTGG - Intergenic
1130093523 15:80840047-80840069 TCTCTTCCCTGCTGGCCTGGGGG - Intronic
1130958668 15:88645262-88645284 CCTCCTCCCTGGTCTCATGCGGG + Intronic
1130969073 15:88718297-88718319 TTTCCTCCCTGGTGACTTTCAGG + Intergenic
1132933235 16:2469117-2469139 CCTCCTCCCTGGGGAGCTGGCGG + Intergenic
1134504008 16:14790824-14790846 TCCCTTCCCTGATGGCCTGCTGG - Intronic
1134576564 16:15338084-15338106 TCCCTTCCCTGATGGCCTGCTGG + Intergenic
1134607348 16:15581557-15581579 ACTCCTCCCTGGTCACTTCCTGG - Intronic
1134725875 16:16418415-16418437 TCCCTTCCCTGATGGCCTGCTGG - Intergenic
1134941558 16:18293444-18293466 TCCCTTCCCTGATGGCCTGCTGG + Intergenic
1136363712 16:29798660-29798682 CCTCCTCCCTTGTGAGCTGCAGG - Exonic
1136521376 16:30798403-30798425 TCTCCTCCCTGCTCAGCTCCAGG - Intergenic
1138502637 16:57457290-57457312 CCTCCTCCCTGCAGACCTGGTGG - Intronic
1139971830 16:70781186-70781208 TCTCTTGCCATGTGACCTGCTGG + Intronic
1140211329 16:72972925-72972947 TCTCCTCCCTGTTCTCCTGTAGG + Intronic
1140681869 16:77393128-77393150 TCACCTCCATGGTGACCAGATGG - Intronic
1141646447 16:85370458-85370480 CCTCCTCCCTGGAGCCCTCCTGG - Intergenic
1142198651 16:88750729-88750751 TCTCCTCGCAGGGGACCTGAGGG + Intronic
1143531745 17:7509147-7509169 TCTGCTCCATGGTGAGCTTCCGG - Exonic
1144753830 17:17667836-17667858 TCTCCTTCCTGCTGCCCTCCAGG - Intergenic
1146671813 17:34742924-34742946 TCTCCACCATGCTGGCCTGCTGG + Intergenic
1146824896 17:36013580-36013602 TCTCATCCCCGATGCCCTGCAGG + Intronic
1147888428 17:43700044-43700066 TCCCATCCCTGGGGACCTTCTGG + Intergenic
1148080535 17:44965701-44965723 CCTCATCTCTGGGGACCTGCTGG + Intronic
1148146949 17:45371991-45372013 TCTCCTCCCTGGCCCCCAGCAGG + Intergenic
1148991698 17:51671800-51671822 TCTCCTCCATGCTGGCCTTCTGG + Intronic
1151464510 17:74275925-74275947 TCTCCTGCCAGGTGCCATGCAGG + Intronic
1151752293 17:76046506-76046528 TCTCCTGCCTCGTGAGTTGCTGG - Intronic
1151931499 17:77234931-77234953 GGCCCTCCCTGGTGATCTGCTGG - Intergenic
1151993661 17:77595085-77595107 TCACCTCCCTGGGGCTCTGCTGG + Intergenic
1152433892 17:80263699-80263721 TTTCCTCCTTGGAGACATGCTGG - Exonic
1152683283 17:81681087-81681109 CCTCCTTCCTGGAGACCTGCTGG - Intergenic
1152915597 17:83033238-83033260 ACTCCCCCATGGAGACCTGCCGG + Intronic
1153456977 18:5293791-5293813 TCTCCTCCCATGTTACCTGTTGG - Intronic
1154111071 18:11568768-11568790 TCTTCTCCCAGGGGAGCTGCGGG + Intergenic
1156263760 18:35467854-35467876 TGTCCTCCCTGGGGAAATGCGGG + Intronic
1157298783 18:46464785-46464807 TCTCCTCCCCAGTGCTCTGCAGG + Intergenic
1157442049 18:47718953-47718975 TCTCCTCCCTCACGGCCTGCAGG + Intergenic
1159674061 18:71259966-71259988 TCTCCAACCTGGTAACCTACTGG - Intergenic
1160511946 18:79457777-79457799 GCTGCTCCCTGCTGGCCTGCTGG + Intronic
1160563358 18:79772424-79772446 TCGCCTGCCTGATGACCTGGGGG - Intergenic
1160685677 19:435492-435514 CCGCCTCCCTCGTGACCAGCAGG + Intronic
1160702900 19:517238-517260 CCTCCTCCCTGGTCTCCTCCAGG - Intronic
1160848458 19:1177689-1177711 TTTCCTCCCTCGTGAAATGCAGG - Intronic
1161285770 19:3467529-3467551 TCTGCTGCCTGGGGACCTGCAGG - Intronic
1162561245 19:11419197-11419219 CCGCATCCCTGGTGACCCGCAGG - Intronic
1162932996 19:13966485-13966507 TCTCCACCAGGGTGAACTGCAGG + Exonic
1163361820 19:16851595-16851617 TCTGTTCCCTGGTCACATGCTGG - Intronic
1163761418 19:19138557-19138579 CCTCGTCCCTGGTGATTTGCCGG - Intergenic
1165363570 19:35351029-35351051 TCTCCTCCCTGCTGCCCCGCCGG + Intergenic
1165365712 19:35363488-35363510 TCTCCTCCCTGCTGCCCCGCCGG + Intergenic
1166897968 19:46036043-46036065 TCTCCTCCCTGGTGTCCACCTGG + Intergenic
1166965894 19:46529154-46529176 TCCCCAGCCTGGTGATCTGCTGG - Intronic
1167136789 19:47621145-47621167 TCCACTCCCAGGTGAACTGCAGG - Intronic
1167274441 19:48528067-48528089 TCTCTGCCCTGGTGACAGGCTGG + Intergenic
1168287751 19:55342869-55342891 TCTCCTCCAAGGATACCTGCAGG - Intronic
925107152 2:1301333-1301355 TGTCCTCCAGGGGGACCTGCAGG + Intronic
925333094 2:3074084-3074106 TGTCCTACCTGGTGACATCCAGG + Intergenic
925616810 2:5751572-5751594 GCTCCTCCCTGGTGCACAGCAGG + Intergenic
926767687 2:16336647-16336669 TGTCATCCCTGGTGCCATGCAGG + Intergenic
927112590 2:19874606-19874628 TGTCTTCCCTGGTGACCAGTTGG + Intergenic
928443278 2:31311442-31311464 TCTCAGCCCTGTTCACCTGCTGG - Intergenic
929465629 2:42141319-42141341 TCTCCTCCCTGCTCCCCTGCTGG - Intergenic
931693220 2:64852813-64852835 TCTCCATTCTGGTGAGCTGCAGG - Intergenic
931943668 2:67281462-67281484 TGTCCTCCCAGGTGAGCTCCTGG - Intergenic
932227304 2:70052785-70052807 ACTCCTCCCTGCACACCTGCAGG + Intergenic
932793168 2:74673435-74673457 TCTCCTCCCTGTCGCCCTGCAGG + Exonic
933648357 2:84830206-84830228 TCTCCTTCCTGTTCTCCTGCAGG - Intronic
933662495 2:84939201-84939223 TCCCTTCCCTGCAGACCTGCTGG - Intergenic
933774665 2:85764917-85764939 TCATCTGCCTGGTGACCTGGTGG - Intronic
934147194 2:89106829-89106851 TCACTTCCCTGGTTGCCTGCAGG + Intergenic
934222077 2:90093765-90093787 TCACTTCCCTGGTTGCCTGCAGG - Intergenic
934719567 2:96564197-96564219 TCTCCTGCCTGGTTCCCTGGAGG + Intergenic
935815678 2:106843828-106843850 TCTCCTTCCTGGAGACCAGGAGG - Exonic
936971100 2:118177098-118177120 TCCCCTCCCTGCTGTCCTGATGG + Intergenic
937145351 2:119639413-119639435 TCTCCTGCCTGGAGTGCTGCTGG + Intronic
937439079 2:121901860-121901882 CCTGCTGCCTGGTGACCCGCTGG - Intergenic
937957790 2:127431651-127431673 TCTCCTCCTTACTGACCTGGGGG + Intergenic
938262103 2:129903615-129903637 TCTGCATCCTGGTGACCTGTGGG + Intergenic
939211074 2:139175447-139175469 TCTCCTCTCTGGTTTCCAGCAGG + Intergenic
940790422 2:158025418-158025440 GCTCCTCCCTGCAGGCCTGCTGG - Intronic
942591078 2:177547608-177547630 TTTTCTCCCTGGTGTCCTGGAGG - Intergenic
947393337 2:229662605-229662627 TCTCCTCCCTCATGGCCTTCAGG + Intronic
948974987 2:241458461-241458483 CCTCCTTCCTGGTGCCCTGAGGG + Intronic
1170581145 20:17700556-17700578 TCCACCTCCTGGTGACCTGCTGG + Intronic
1170700486 20:18699039-18699061 CAAACTCCCTGGTGACCTGCTGG - Intronic
1171284974 20:23929526-23929548 TCTCCTCACTGCTGAGGTGCTGG - Intergenic
1172104933 20:32511121-32511143 TTTTCTCCCTGAAGACCTGCAGG + Intronic
1173929858 20:46809541-46809563 TCTCCTCCCTTGTCACCTGTGGG - Intergenic
1174376942 20:50132536-50132558 TGTCCTCCCTGGACACCTGATGG + Intronic
1174402188 20:50282125-50282147 CCTCCTCCCTGCTGACCTTGGGG + Intergenic
1174404087 20:50292600-50292622 TCTCCTGCCTCTTGAGCTGCAGG + Intergenic
1176075273 20:63245441-63245463 CCTCCTGCCTGGGGACCTGCAGG + Intronic
1177119188 21:17121470-17121492 TCGCATCCCAGGTGACTTGCAGG + Intergenic
1178089115 21:29143040-29143062 GTTTGTCCCTGGTGACCTGCAGG + Intronic
1179156857 21:38858559-38858581 TCTCCTCCCTTGAAACCTGGGGG - Intergenic
1179332816 21:40421840-40421862 TCTTTTCCCAGGTGCCCTGCAGG + Intronic
1179923662 21:44521095-44521117 TCACCTCCCTGGTGTCCTTCTGG - Intronic
1180248229 21:46562568-46562590 TCTCACCCCTGCTGCCCTGCAGG - Intronic
1180639331 22:17285745-17285767 TCTGCTTCTGGGTGACCTGCAGG + Intergenic
1180930756 22:19589259-19589281 TCTTCTTCCTCATGACCTGCTGG + Intergenic
1180998031 22:19975158-19975180 CCTCCACCCTGGTGACATGCAGG + Intronic
1181040805 22:20191832-20191854 ACCCCTCCCTGGTGCTCTGCTGG + Intergenic
1181167158 22:20989875-20989897 TCTCCTCCCTGGTGACCTGCGGG + Intronic
1182621504 22:31621095-31621117 TCCCTTCCCGGGTGACCAGCTGG + Exonic
1182623032 22:31628133-31628155 TTTCCTCCCTGGCGATCTTCTGG - Exonic
1183309210 22:37100386-37100408 TCTCTCCCCTGGAGCCCTGCAGG - Intronic
1183370582 22:37429485-37429507 CCTTCTCCCTGGAGACCTCCAGG + Intergenic
1183818405 22:40323196-40323218 TTTACTACCTGGTGACCTTCTGG + Exonic
1184431616 22:44444478-44444500 GCTCCACCTTGGTCACCTGCAGG + Intergenic
1184441181 22:44517157-44517179 TCTTCTCCCTGGTGCCATGCTGG - Intergenic
1185132329 22:49046315-49046337 TCACCTTCCTGTTGACCTGCAGG - Intergenic
1185367247 22:50442318-50442340 TCCCCGCCCTGTTGACCAGCAGG + Intronic
1185395828 22:50587414-50587436 TCCCCTCCTTTGTGGCCTGCTGG - Intronic
949111549 3:267276-267298 TCATTTCCCTGGTGACCTGTGGG + Intronic
950298434 3:11852314-11852336 TGTACTCTCTGGTGAACTGCTGG - Intergenic
950964852 3:17139022-17139044 CCTCCTCCCTGGGGAGCTCCTGG + Intergenic
953024543 3:39137315-39137337 CCTTCTCCCTGGTGGCCAGCCGG - Exonic
953385123 3:42501983-42502005 CCTGCTCCCGGGTGACCTGGTGG - Intronic
953463721 3:43102021-43102043 CCTCCTCTCTGCTGGCCTGCAGG - Intronic
953711576 3:45275627-45275649 TCTGCTCTCTGCTTACCTGCTGG + Intergenic
953856413 3:46502798-46502820 TCACTTTCCTGCTGACCTGCTGG - Intergenic
954305005 3:49721013-49721035 CCTCCTCACTGGTGGGCTGCAGG - Exonic
955664718 3:61338098-61338120 TCAGCTCCCTGATGACTTGCAGG + Intergenic
956843521 3:73161373-73161395 TCTCCTCCCTCCTGCCCTCCTGG + Intergenic
960155546 3:114294137-114294159 TTTCCTCCCTGCTGCTCTGCTGG - Intronic
960574746 3:119218536-119218558 TCTGCAGCCTAGTGACCTGCTGG + Intronic
960592355 3:119378405-119378427 GCTCATCCCTGGAGGCCTGCAGG - Intronic
961282959 3:125777911-125777933 TCTGCACCCTGGTGTCCTGGGGG + Intergenic
961324198 3:126100483-126100505 TCCCTGCCCTGGTGAGCTGCTGG + Intronic
961457887 3:127033271-127033293 TCTCCTTCCTGGATACCTCCTGG - Intronic
961486525 3:127221216-127221238 TCTCCTCCCTGTCACCCTGCAGG - Intergenic
962530778 3:136277876-136277898 GCTCCTCCCAGGCCACCTGCAGG + Intronic
962829153 3:139124346-139124368 GCTCCTCTCTGGTAACCTGATGG + Intronic
963106085 3:141648539-141648561 TCTCCTCCCCTGTCATCTGCTGG + Intergenic
963150786 3:142043664-142043686 TCTCCTCCTTCTTGGCCTGCAGG + Intronic
966908289 3:184543454-184543476 TCTCCTCCCCTGTGACCCTCTGG + Intronic
968123661 3:196143316-196143338 ACTGCTCGCTGCTGACCTGCCGG - Intergenic
968442303 4:630091-630113 TCTCCTCTCTGGTGCCCTCTGGG - Intronic
968512193 4:1000687-1000709 GCTCCTCCCAGGTGAGCTGTGGG + Exonic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969014758 4:4096511-4096533 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
969371345 4:6733365-6733387 TCTCCCCTCTGGCCACCTGCTGG + Intergenic
969739183 4:9011936-9011958 TCTGCACCCTGGTGTCCTGGGGG + Intergenic
971660514 4:29408223-29408245 GCTCTTACCTTGTGACCTGCTGG - Intergenic
972042076 4:34615344-34615366 TCTAGTCCCTGGTGATCTGTGGG + Intergenic
976298005 4:83491057-83491079 ACCTCTACCTGGTGACCTGCAGG + Intronic
977184509 4:93919985-93920007 TCTCATCCCTGGGGAATTGCAGG + Intergenic
977994154 4:103482425-103482447 TCTGCTCCCCGGTGAGCTGTGGG - Intergenic
980471963 4:133263909-133263931 TCACATCCCCTGTGACCTGCAGG - Intergenic
981931697 4:150196924-150196946 TCTCATCTCAGGTGATCTGCTGG - Intronic
983303243 4:165954562-165954584 TCTCTTGCCCTGTGACCTGCAGG + Intronic
985551130 5:534169-534191 GCACCTCCCTGTGGACCTGCCGG - Intergenic
986201830 5:5586234-5586256 TCACCTCCCTGGCCATCTGCTGG + Intergenic
991247465 5:64523179-64523201 TCACCTACCTGGGGCCCTGCTGG - Intronic
991499835 5:67266119-67266141 TCTCCTAACTGGGGACCAGCAGG - Intergenic
992494589 5:77280333-77280355 TCTCCTCCCTGTCCTCCTGCAGG + Intronic
994318485 5:98361339-98361361 TCTGTTGCTTGGTGACCTGCAGG - Intergenic
995011803 5:107264685-107264707 TCACCCGCTTGGTGACCTGCTGG + Intergenic
997673455 5:135695126-135695148 TCTCTTCCCTGGATACTTGCGGG + Intergenic
997898566 5:137742166-137742188 TCTACTCCTTGCTGACCTGTTGG - Intergenic
998421758 5:141994029-141994051 TCTCCTCCCAGGTGTCCAGAAGG - Intronic
999153343 5:149441371-149441393 CCTCCACCCTGGTGGCCTCCAGG - Intergenic
999266302 5:150269159-150269181 CCTCCTGCCTGGGGACCTGGGGG + Intronic
1000135096 5:158340256-158340278 TCTTCACCCTGGTAACCTGTTGG + Intergenic
1000633260 5:163615200-163615222 TCTCCTCCCTAGTTTCCTGGTGG + Intergenic
1001097153 5:168784506-168784528 TCTGCTCCCTGGAAACTTGCTGG + Intronic
1001389713 5:171369109-171369131 TCACATCCCCTGTGACCTGCAGG + Intergenic
1002427720 5:179185904-179185926 CCTTCTCCCTGGCTACCTGCTGG - Intronic
1002469992 5:179429386-179429408 TCTTCTTCCTGGTGACAGGCAGG + Intergenic
1002472756 5:179446975-179446997 GCTCCTCCCTTGTGGTCTGCAGG - Intergenic
1002481465 5:179503687-179503709 GCTCCTCCCTTGTGGTCTGCAGG + Intergenic
1003323611 6:5075054-5075076 TCTCTTGCCATGTGACCTGCTGG + Intergenic
1005165219 6:22911785-22911807 TCTCCTACCTGGTGTGCTACTGG - Intergenic
1005990500 6:30899031-30899053 TCTCCTCCACTCTGACCTGCCGG - Exonic
1006717876 6:36131497-36131519 TCTCCTCCCTGCTCCCCTGACGG + Intronic
1007507774 6:42349540-42349562 TTTCCTACCTGGTGTCCTGAAGG + Intronic
1007706880 6:43796520-43796542 CCTCCTCCCTGATGACCTGCCGG + Intergenic
1009538474 6:64922790-64922812 TCTGTTACCTTGTGACCTGCAGG - Intronic
1010044496 6:71425312-71425334 TCTCCTACATGCTGACCTTCTGG - Intergenic
1012667097 6:101985413-101985435 TATCTTCCCTGGTGACATTCTGG + Intronic
1013078471 6:106791733-106791755 TGGCCTCCCTGGTGGCTTGCAGG - Intergenic
1013948427 6:115750604-115750626 TCCCCTACCTGGTTACCTACGGG - Intergenic
1014769003 6:125440009-125440031 TCTCCACCTGTGTGACCTGCTGG + Intergenic
1015203870 6:130613376-130613398 TCTCCACCCTGATGAGCTGAAGG + Intergenic
1015323258 6:131899569-131899591 TCTGCTGCCTGGTGAACTGAAGG + Intergenic
1016495744 6:144659881-144659903 TCACCTCACTAATGACCTGCAGG - Intronic
1017887097 6:158608348-158608370 TCTCCTTCCTGGTCAACAGCTGG + Exonic
1018952432 6:168387809-168387831 TCTCCTCCCTGGGGACCTCCAGG - Intergenic
1019026078 6:168964136-168964158 TCTCCTCCCTGTGCACTTGCAGG + Intergenic
1020100836 7:5393594-5393616 CCTCCTCCCAGGTGTCCTGTAGG - Intronic
1020210400 7:6154276-6154298 TCCCCTTCCGGGTGACCGGCCGG - Exonic
1021921869 7:25493928-25493950 TCACCTTCATGCTGACCTGCTGG + Intergenic
1022902597 7:34825602-34825624 CACCCTCCCTGGTGACCTTCAGG - Intronic
1022961486 7:35430463-35430485 ACAACTCCCTGGGGACCTGCTGG - Intergenic
1024081456 7:45859433-45859455 TCTGCTCCCTGTTCCCCTGCTGG - Intergenic
1024482796 7:49882655-49882677 TCTCATCCCTGGTGAGCTTTTGG + Intronic
1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG + Intronic
1029073430 7:97918140-97918162 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1029506838 7:100968034-100968056 TCTCACCCCTGGAGCCCTGCGGG + Exonic
1032267851 7:130381173-130381195 TCTCCCCTCTTCTGACCTGCAGG - Exonic
1032430025 7:131853167-131853189 CATCCTCCCTGGTGTCCTGATGG - Intergenic
1033350732 7:140559700-140559722 GCTCGTACCTGGTGAACTGCTGG + Exonic
1033629022 7:143139222-143139244 TCTCCTCCCTGGTGGCTGGTGGG - Intronic
1035072665 7:156156797-156156819 TCTCCTCCCAGGTGGGCTCCTGG + Intergenic
1035285448 7:157803316-157803338 TTTCCTCCCCGGTGACCAGTAGG + Intronic
1035422863 7:158743603-158743625 TGTCCTCACTGGTGAGCAGCTGG + Exonic
1035912278 8:3580602-3580624 TTTTCTCCCAGGTGACCTTCAGG + Intronic
1036238651 8:7064400-7064422 CCTCTCACCTGGTGACCTGCAGG + Intergenic
1036256481 8:7210589-7210611 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1036308531 8:7669174-7669196 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1036889961 8:12590098-12590120 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1036897574 8:12648259-12648281 TCTGCACCCTGGTGTCCTGGGGG - Intergenic
1037885931 8:22596357-22596379 TCTCCTCCCAGGGGTCCTGAGGG + Intronic
1038953818 8:32445841-32445863 TCTCCTGCCTAGTGATCTTCAGG - Intronic
1039610870 8:38918175-38918197 TCCCCTCCCTGCTGATCAGCAGG - Intronic
1039805223 8:40992017-40992039 GCTCCTCCATGGTGACAGGCTGG + Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045690996 8:104759575-104759597 TCTCCTGTCAGGAGACCTGCAGG - Intronic
1046585725 8:116147308-116147330 TCTCTTCACTGCTGTCCTGCAGG + Intergenic
1047299159 8:123597984-123598006 TCTCCGCCCTGGGGAGCTTCAGG + Intergenic
1048411471 8:134178506-134178528 TCTCCTCCCTGCTGGCTTCCAGG + Intergenic
1048443827 8:134478706-134478728 GCTCCTCCTCGGTGACCTGCGGG + Exonic
1048538635 8:135322001-135322023 TCTCTTCTGTGGTCACCTGCAGG - Intergenic
1049108897 8:140630561-140630583 CCTCCTCACTGGGGATCTGCTGG - Intronic
1049347315 8:142145859-142145881 TCGGCTCCCTGCTGCCCTGCGGG + Intergenic
1049400912 8:142426814-142426836 GCTCCTCCCTGGGGCCCAGCGGG + Intergenic
1049532108 8:143159965-143159987 TCTTCTCCCCGGGGAGCTGCAGG + Intronic
1049845394 8:144798592-144798614 TCTGCCCCCGGGTGGCCTGCGGG - Intergenic
1051147502 9:14043130-14043152 TCTCCTCCATGGTGAGTTGAAGG + Intergenic
1052362136 9:27573125-27573147 TCTCCTTCCCGGGGACCCGCTGG - Intronic
1057208633 9:93187654-93187676 TCTCCTCACTGGTGACCTTGGGG - Intronic
1059236848 9:112768166-112768188 TTACCTCCCTGGTGCCCTCCTGG + Intronic
1059441311 9:114308610-114308632 TCTCTTCCCTGGTGACTCGAAGG + Intronic
1060552705 9:124493029-124493051 CCTCCTGCCCGGTGACCAGCAGG + Exonic
1061821944 9:133233826-133233848 CGTCCTCCTTGGTGGCCTGCAGG + Intergenic
1061831968 9:133301886-133301908 TCTGCTCCCTGGTGATTTGCAGG + Intergenic
1061882949 9:133577133-133577155 GCTCCACCGTGGGGACCTGCTGG - Intergenic
1062197826 9:135284485-135284507 GTTCCTTCCTGCTGACCTGCGGG - Intergenic
1062237354 9:135516688-135516710 CGTCCTCCTTGGTGGCCTGCAGG - Intergenic
1062415243 9:136445646-136445668 TCTCCTCCCTGGGAACCCTCAGG + Exonic
1186526690 X:10255469-10255491 TCTCTGCCCTGGTGACATTCTGG + Intergenic
1188262111 X:28034359-28034381 GCTCCTCCCTGGTATCCTGGAGG - Intergenic
1189195540 X:39149121-39149143 TCACCTCCATGGTGATCTGAAGG - Intergenic
1189308173 X:40002931-40002953 TCTGCACCCTGGTGAGCTGAGGG - Intergenic
1194977254 X:100408339-100408361 TCTTCTGCTTGGTGACCAGCAGG + Exonic
1195310963 X:103631334-103631356 TCTCATCCCTGCTGACGTGCTGG + Intergenic
1195682698 X:107560766-107560788 TCTTCTCTTTGATGACCTGCAGG - Exonic
1197718577 X:129728330-129728352 TCTACTCCCCGGAGACCTCCAGG - Intergenic
1199319625 X:146422945-146422967 ACTGCTCCCTGGTCACCTGCTGG - Intergenic