ID: 1181167283

View in Genome Browser
Species Human (GRCh38)
Location 22:20990632-20990654
Sequence TGAGCTCTGCAAACAGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 447}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181167276_1181167283 12 Left 1181167276 22:20990597-20990619 CCTCTTGCACCTGGTGGCCATGG 0: 1
1: 0
2: 1
3: 15
4: 204
Right 1181167283 22:20990632-20990654 TGAGCTCTGCAAACAGCAGGAGG 0: 1
1: 0
2: 3
3: 55
4: 447
1181167279_1181167283 -5 Left 1181167279 22:20990614-20990636 CCATGGTAACCATCCTTGTGAGC 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1181167283 22:20990632-20990654 TGAGCTCTGCAAACAGCAGGAGG 0: 1
1: 0
2: 3
3: 55
4: 447
1181167278_1181167283 3 Left 1181167278 22:20990606-20990628 CCTGGTGGCCATGGTAACCATCC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1181167283 22:20990632-20990654 TGAGCTCTGCAAACAGCAGGAGG 0: 1
1: 0
2: 3
3: 55
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181167283 Original CRISPR TGAGCTCTGCAAACAGCAGG AGG Intronic
900300406 1:1974065-1974087 GCAGCTCTGCAGAGAGCAGGAGG - Exonic
902220317 1:14960482-14960504 TGAGCTCTGCAGACTGTGGGTGG + Intronic
902963150 1:19978743-19978765 TGATCACTGCCAACAGTAGGAGG + Exonic
904402984 1:30269085-30269107 TGAGTCCTGCAAACTGCATGGGG - Intergenic
905264031 1:36738972-36738994 TGAGCCCGGGAAACAGAAGGTGG + Intergenic
905415168 1:37799085-37799107 TCAGCTCTGCAAAGATCCGGAGG + Intronic
906346461 1:45018525-45018547 TGAACTGGGCAAACTGCAGGTGG + Exonic
906734875 1:48115777-48115799 AGGGCTCTACAATCAGCAGGTGG - Intergenic
906826968 1:48992511-48992533 AGAACTCTACAATCAGCAGGCGG + Intronic
907675021 1:56510179-56510201 TGAGCTTTGCTCTCAGCAGGAGG - Intronic
908044101 1:60149540-60149562 TGATCTCAGCAGTCAGCAGGAGG + Intergenic
908397503 1:63739972-63739994 AGGGCTCTACAATCAGCAGGTGG + Intergenic
909084416 1:71154688-71154710 AGGGCTCTACAATCAGCAGGTGG + Intergenic
909271393 1:73627616-73627638 GGTGCTCTACAATCAGCAGGTGG - Intergenic
909316340 1:74223985-74224007 TGGGCTCTATAATCAGCAGGAGG - Intronic
910289866 1:85589293-85589315 AGGGCTCTACAATCAGCAGGTGG - Intergenic
910803322 1:91166295-91166317 TGTGCTTTGCAGCCAGCAGGTGG + Intergenic
910971742 1:92862862-92862884 TGAGCATTGCAGACAGAAGGAGG - Intronic
912013683 1:105005149-105005171 TGAGGTATGCAAACAACTGGAGG + Intergenic
912873034 1:113327600-113327622 GGGGCTCTACAATCAGCAGGTGG + Intergenic
912953722 1:114137917-114137939 TGAGCTCTACAAGCAGAAGTCGG - Exonic
913092967 1:115492377-115492399 AGAGCTTTGGAAAAAGCAGGAGG + Intergenic
913451517 1:118995835-118995857 TCAGCTCAGAAAACAGCAGAAGG + Intergenic
915009810 1:152675216-152675238 TTGGCTCTGGAAAGAGCAGGAGG - Intergenic
917624162 1:176829301-176829323 GATGCTCAGCAAACAGCAGGAGG + Intronic
917637935 1:176955214-176955236 AATGCTCTGCAAACTGCAGGTGG + Intronic
918929159 1:190831774-190831796 TAAGAGCTGCAAACAGCAGTAGG + Intergenic
919336712 1:196244815-196244837 AGAGCTCTACAAACAGAAGGTGG - Intronic
920077559 1:203348234-203348256 AGAGCCCTGCCAGCAGCAGGAGG + Exonic
920732883 1:208504502-208504524 TGAGCTGTGCCAGCAGCAGGGGG + Intergenic
921069990 1:211650706-211650728 AGAGCTGTGCAAAGAGCAGCTGG - Intergenic
921410931 1:214835799-214835821 TGGGCTCTGCGAGCAGCAGTGGG + Intergenic
921456838 1:215380998-215381020 TGGGCACTACAATCAGCAGGTGG - Intergenic
922606963 1:226895438-226895460 TGAACACAGCAAGCAGCAGGAGG - Exonic
924490729 1:244535287-244535309 AGGGCTCTACAACCAGCAGGTGG + Intronic
924648991 1:245905680-245905702 GGGGCTCTACAATCAGCAGGTGG - Intronic
1064123059 10:12636138-12636160 AGAGCTCTGCAGACAGATGGTGG - Intronic
1065467673 10:26043340-26043362 GGAGTTCTACAATCAGCAGGTGG + Intronic
1065921929 10:30400258-30400280 AGGGCTCTGCAGTCAGCAGGTGG - Intergenic
1066367609 10:34792167-34792189 AGAGCTCCGCAAAGAGCACGTGG - Intronic
1066450701 10:35526947-35526969 TGAGCTCTGCACTTAGCATGTGG - Intronic
1069391813 10:67944064-67944086 AGGGCTCTGCAGTCAGCAGGTGG - Intronic
1069814442 10:71184726-71184748 CCAGCTCTGCAGACAGCAGCGGG + Intergenic
1069933484 10:71899598-71899620 GGGGCTCTGCAATCAGCTGGTGG + Intergenic
1070059297 10:72967105-72967127 AGGGCTCTTCAATCAGCAGGTGG + Intergenic
1070162227 10:73873707-73873729 TGAGCTCTGGAAACGTCTGGGGG + Intronic
1071799345 10:89042097-89042119 TGGGCTCTACAATCAGCAGGTGG + Intergenic
1072862777 10:99023462-99023484 GGAGCTCTACAATCAGCAAGTGG - Intronic
1073134245 10:101211229-101211251 TGAGCTCTGGAGACAGAAGGGGG - Intergenic
1073708122 10:106010232-106010254 GGTGCTCTACAATCAGCAGGTGG + Intergenic
1073827023 10:107336225-107336247 AGGGCTCTACAACCAGCAGGTGG + Intergenic
1074408558 10:113202262-113202284 AGGGCTCTGCAATCAGCAGGTGG - Intergenic
1074638026 10:115344159-115344181 GGGGCTCTACAATCAGCAGGTGG + Intronic
1075009306 10:118854002-118854024 TGAGCACCGCAAACAGCAGGAGG + Intergenic
1076094707 10:127721479-127721501 GGGGCTCTACAATCAGCAGGTGG - Intergenic
1076154019 10:128188945-128188967 AGAGCTCTGCAGAAGGCAGGTGG + Intergenic
1076494104 10:130885557-130885579 TCAGCTCTGCCAACACCAGCTGG - Intergenic
1077228666 11:1449171-1449193 TGAGACCTGCACACAGCAGGAGG - Intronic
1078064113 11:8066699-8066721 TGAGCTCTGAAGAGGGCAGGAGG - Intronic
1079038021 11:17037404-17037426 GGGGCTCTTCAATCAGCAGGTGG - Intergenic
1079183594 11:18215617-18215639 GGGGCTCTACAATCAGCAGGTGG - Intronic
1079328853 11:19517549-19517571 TCAGCCCTGCAAAGAGGAGGTGG + Intronic
1079473802 11:20807576-20807598 AGGGCTCTGCATTCAGCAGGTGG + Intronic
1079863122 11:25699501-25699523 TGAGTACAGCACACAGCAGGGGG + Intergenic
1079961331 11:26927822-26927844 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1081212509 11:40354364-40354386 AGAGCTCTTCAGTCAGCAGGTGG + Intronic
1082823722 11:57562442-57562464 AGGGCTCTGCAATCAGCAGGTGG - Intronic
1083152338 11:60799678-60799700 TGAGCTCTGCAAATACCTGGGGG - Intronic
1083582739 11:63835493-63835515 TGAGCTCTGCAGACATCTAGGGG - Intergenic
1084763813 11:71294510-71294532 TGAGCTCTTCAATCAGCTTGTGG + Intergenic
1084792533 11:71483624-71483646 TGAGCTCAACAAACAGGATGGGG - Intronic
1085572034 11:77568338-77568360 AGAGATCTACAATCAGCAGGTGG + Intronic
1085639955 11:78187419-78187441 TGAGCTGCGCAAAAGGCAGGAGG + Intronic
1086746565 11:90435043-90435065 TCAGCCCTGCAACCAGCAGGAGG - Intergenic
1087178552 11:95119694-95119716 TGGGCTCCACAATCAGCAGGTGG + Intronic
1087299396 11:96414230-96414252 AGAGCTCTACAATCAGCAGATGG - Intronic
1088045847 11:105449520-105449542 TGGGCTGTACAATCAGCAGGTGG - Intergenic
1088154766 11:106790034-106790056 TGGGCTCTAAAAGCAGCAGGTGG + Intronic
1088829081 11:113520108-113520130 TGAGTGCTGCACACAGCTGGGGG - Intergenic
1090458669 11:126870661-126870683 TGAGCTGTGCAAATAGATGGCGG - Intronic
1091306245 11:134538100-134538122 TGAGCTCTGCAAACGTCTGGTGG + Intergenic
1091367834 11:135037200-135037222 TGAGCACAGCAGACAGAAGGAGG + Intergenic
1091918235 12:4284374-4284396 TTAGCTCTGGAATCAGAAGGAGG - Intronic
1092160999 12:6315565-6315587 GGAGCTCTGCCACCAACAGGAGG + Exonic
1093608027 12:21118207-21118229 TGGGCTCTGCAGTCAGCAGGTGG + Intronic
1094737616 12:33252924-33252946 GGAGCTCTGAAAACAGAATGGGG + Intergenic
1095227623 12:39695718-39695740 AGGGCTCTGCAATCAGCAGGTGG - Intronic
1095633164 12:44401379-44401401 TGACCTCTGGAAAAAGCAGGTGG + Intergenic
1096817650 12:54211401-54211423 TGGGATCTCCAAACAGTAGGAGG + Intergenic
1096872053 12:54599110-54599132 TCAGCTATGCAGACAGCAAGAGG + Intergenic
1099355409 12:81628910-81628932 TGAGCACTGAAAACAACAGGAGG - Intronic
1099799147 12:87435237-87435259 TGAGGTATACAAACAGCAGATGG - Intergenic
1099992308 12:89737188-89737210 GGGGCTCTTCAATCAGCAGGTGG - Intergenic
1102145945 12:110655284-110655306 TGAGCTCAGCAAGCACCAGGAGG + Exonic
1102318041 12:111905585-111905607 GGGGCTCTACAATCAGCAGGTGG - Intergenic
1104103060 12:125633957-125633979 GGGGCTCTACAATCAGCAGGTGG + Intronic
1104451241 12:128869758-128869780 TGAGCTCTGCACCGAACAGGAGG - Intronic
1104634692 12:130430333-130430355 TGAGCCCCGCATCCAGCAGGAGG + Intronic
1105093935 13:16337311-16337333 TGAACTCAGCTAACAGTAGGTGG + Intergenic
1105095021 13:16355050-16355072 TGAACTCAGCTAACAGGAGGTGG + Intergenic
1105116604 13:16707733-16707755 TGAACTCAGCTAACAGCAGGTGG + Intergenic
1105148042 13:17221080-17221102 TGAACTCAGCTAACAGGAGGTGG + Intergenic
1105816605 13:24041868-24041890 GAAGCTTTGCAAAGAGCAGGTGG + Intronic
1105834990 13:24202314-24202336 TTAGCTCTGCAAACAAAAGAGGG - Intronic
1107348451 13:39488397-39488419 TGAGCTCTGCGAACAGGTGATGG + Intronic
1107601872 13:42022207-42022229 TGAGGACTGGAAATAGCAGGAGG + Intergenic
1107754136 13:43600639-43600661 AGGGCTCTACAATCAGCAGGTGG - Intronic
1107829150 13:44358973-44358995 TTAGTTCTGCCCACAGCAGGTGG - Intergenic
1108428341 13:50328077-50328099 TCAGCTTGGCAAACAGCAGCTGG - Intronic
1108973325 13:56403457-56403479 AGGGCTCTACAATCAGCAGGTGG - Intergenic
1109300749 13:60587519-60587541 TTAGCTCTGCAATCTGCAGATGG - Intergenic
1111141616 13:84127113-84127135 TGAGGTATGCAGACAACAGGAGG + Intergenic
1111542792 13:89690072-89690094 AGGGCTCTGCAATCAGCAGGTGG - Intergenic
1112006273 13:95256384-95256406 TGAGCCCTGCATCTAGCAGGTGG - Intronic
1112203103 13:97297397-97297419 TGAGCTCTGGAAACACCTTGTGG + Intronic
1115463076 14:33683880-33683902 TGTGCTCTGCATACACCAAGAGG - Intronic
1115821084 14:37212683-37212705 TGAACTCTACAGTCAGCAGGAGG - Intronic
1115861279 14:37688404-37688426 AGAGCTCTACGATCAGCAGGTGG - Intronic
1116275511 14:42827059-42827081 AGAACTCTACAATCAGCAGGTGG + Intergenic
1116407149 14:44579815-44579837 GGTGCTCTACAATCAGCAGGTGG - Intergenic
1117483028 14:56168200-56168222 GGGGCTCTGTAATCAGCAGGTGG + Intronic
1117504397 14:56388200-56388222 AGGGCTCTACAACCAGCAGGTGG + Intergenic
1117870863 14:60198705-60198727 CGAGCTCTTCAATCAGCAGGTGG - Intergenic
1118289186 14:64504446-64504468 CCAGCTGTGCAAACAGGAGGAGG + Intronic
1118316103 14:64727075-64727097 AGAGCTTTACGAACAGCAGGTGG + Intronic
1119165512 14:72489162-72489184 TGAGATGAGCAAACAGCCGGTGG - Intronic
1120003705 14:79333031-79333053 GGAGCTTTGCACACAGCAGGGGG - Intronic
1121273466 14:92652492-92652514 TGAGCTCTGCACACAGGCGATGG + Exonic
1122685889 14:103506135-103506157 TGAGCCCTGGACACAGCACGGGG + Intergenic
1122717985 14:103706802-103706824 TGGGCTCAGCTGACAGCAGGAGG - Intronic
1122723883 14:103737802-103737824 TCACCTCTGCAAACAGCTGGTGG - Exonic
1122997760 14:105274767-105274789 TGTGCTCTGCAGACAGAAGTGGG - Intronic
1123111999 14:105876371-105876393 GGGGCTCTGCAATGAGCAGGTGG + Intergenic
1125272376 15:37953178-37953200 GGGGCTCTACAATCAGCAGGTGG - Intronic
1125276911 15:38003420-38003442 AGGGCTCTGTAACCAGCAGGTGG + Intergenic
1125748920 15:42015440-42015462 TGAGCTCTGAAAACAGCCCATGG - Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1126209138 15:46080065-46080087 GCGGCGCTGCAAACAGCAGGAGG - Intergenic
1126534232 15:49742871-49742893 AGTGCTCTACAATCAGCAGGTGG - Intergenic
1126548695 15:49903204-49903226 TTAGCTCTTCAAACACCAGCTGG + Intronic
1127035273 15:54908918-54908940 TGGGCTCTACAATCAGCAGGTGG - Intergenic
1128235179 15:66062136-66062158 TCACCTCTGCAAAGAGCAGGAGG + Intronic
1129069878 15:72941927-72941949 TGTGCCCTGCTAACAGCTGGTGG + Intergenic
1129235665 15:74222378-74222400 TGAGCTCTGGAAGGAGAAGGAGG + Intergenic
1130961797 15:88664285-88664307 AGTGCTCTACAATCAGCAGGTGG - Intergenic
1131374488 15:91912429-91912451 GTTGCTCTGCAAAGAGCAGGTGG + Intronic
1134165763 16:11928045-11928067 TGAGTACTGCCAACAGCTGGAGG + Intronic
1135364107 16:21837910-21837932 TGAGTACTGCCAACAGCTGGAGG + Intronic
1135546358 16:23369603-23369625 TGACCTCTGCAACCACCAAGAGG + Intronic
1136368653 16:29821896-29821918 TGAGGCCTGCAAAAAGCAGCAGG + Intronic
1136396060 16:29993187-29993209 TGAGCTCTGCCACCCCCAGGAGG - Exonic
1137982132 16:53078942-53078964 TGACCTCTGCAGGCAGGAGGCGG - Intronic
1138488666 16:57363396-57363418 TGAGCCCTGCATAAAGTAGGTGG + Intronic
1138495219 16:57404802-57404824 TCAGCTCTCCCATCAGCAGGCGG - Exonic
1139463592 16:67142004-67142026 TGAGGTATGCAGACAGCTGGAGG + Intronic
1141578820 16:84983286-84983308 AGGGCTCTGCCAACAGCAGATGG + Intronic
1142031709 16:87841752-87841774 AGAGCTCTGCACACAGCACGGGG - Intronic
1143681759 17:8481074-8481096 TGAGCCCTGCACACCGCAGGGGG - Intronic
1143681775 17:8481143-8481165 CGAGCCCTGCACACCGCAGGTGG - Intronic
1144853237 17:18254522-18254544 GGAGCTGTGCATGCAGCAGGGGG + Exonic
1145759630 17:27418866-27418888 TGAGCTATCCATACAGGAGGGGG - Intergenic
1146159613 17:30552840-30552862 TGAGCTATCCATACAGGAGGGGG - Intergenic
1146357195 17:32143932-32143954 AGATTTCTCCAAACAGCAGGTGG - Intronic
1146589956 17:34120348-34120370 TGAGCTGGGAAAAAAGCAGGAGG - Intronic
1148119123 17:45197464-45197486 TGAGCTCTGGATCCAGCAGAAGG + Intergenic
1149180567 17:53931726-53931748 AGGGCTCTGCAATCAGCAGGTGG + Intergenic
1149231356 17:54537573-54537595 AGGGCTCTGCAATCAGCAGGTGG - Intergenic
1149689794 17:58565804-58565826 AGAGCTCTTGAAACAGCAGCAGG - Exonic
1149929781 17:60740092-60740114 TAAGCTCAGAAAACAGCATGCGG - Intronic
1151582323 17:74987601-74987623 CGAGCTCCGCAAGCTGCAGGCGG + Intergenic
1152129681 17:78468525-78468547 TTTGCTCTGCATAGAGCAGGAGG - Intronic
1153074739 18:1149116-1149138 GGGGCTCTACAATCAGCAGGTGG - Intergenic
1153183187 18:2459118-2459140 AGGGCTCTACAATCAGCAGGTGG + Intergenic
1153453919 18:5259926-5259948 TGGGCTCTATAATCAGCAGGTGG - Intergenic
1153753855 18:8260713-8260735 CGATCTCTGCAGAGAGCAGGTGG - Intronic
1154096677 18:11423400-11423422 TGAACTTTCCAAACAGCAGTGGG + Intergenic
1154355285 18:13619849-13619871 TGAGCTGTGCAGAGAGCAGGTGG - Intronic
1155215818 18:23642118-23642140 TGAGGTATGCAAACAACTGGAGG - Intronic
1155443504 18:25885657-25885679 AGGGCTCTACAATCAGCAGGTGG - Intergenic
1155533888 18:26795465-26795487 TGGGTTCTACAATCAGCAGGTGG - Intergenic
1157937059 18:51884497-51884519 AGATCTCTACAATCAGCAGGTGG - Intergenic
1158948925 18:62474238-62474260 AGGGTTCTGCAATCAGCAGGTGG + Intergenic
1159774238 18:72585327-72585349 TGAGGTATGCAAACAACTGGAGG + Intronic
1161001917 19:1914859-1914881 TGTGCTCTGGAAACAGCAGTGGG - Intronic
1162121435 19:8471824-8471846 GCAGCTGTGCAAACACCAGGAGG - Intronic
1162936041 19:13982070-13982092 TGACCTCGGGAGACAGCAGGGGG + Intronic
1164815878 19:31203173-31203195 TGAGCTATGCAACTAGCTGGTGG + Intergenic
1164855052 19:31514151-31514173 TGAGCTGTGCAGAGAGCCGGAGG + Intergenic
1165018207 19:32899958-32899980 TGAGGTCCTCAAAAAGCAGGTGG - Exonic
1166508831 19:43390011-43390033 GGAGCTCTGGAAACAGAAGCAGG - Intergenic
1168241761 19:55092311-55092333 GCAGCTCTGCATACAGCTGGGGG + Exonic
925554655 2:5116706-5116728 TGACCTCTGCAAATAGCTTGTGG + Intergenic
926346715 2:11953700-11953722 TGAGATTTGCAGGCAGCAGGTGG + Intergenic
926602122 2:14855885-14855907 GGGGCTCTACAATCAGCAGGTGG - Intergenic
927309704 2:21616951-21616973 GGGGCTCTACAATCAGCAGGTGG + Intergenic
927594645 2:24385942-24385964 TGAGTTCTACAATCAGCAGGTGG + Intergenic
927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG + Intronic
928293637 2:30061744-30061766 AGAGCTCTACCATCAGCAGGTGG - Intergenic
928442472 2:31303716-31303738 TGAGCTGTGCAAAGAAGAGGGGG - Intergenic
928484196 2:31712561-31712583 AAAGCTCTGCAAGCATCAGGTGG - Intergenic
928682616 2:33717821-33717843 TGTTCTCTGCACACTGCAGGTGG - Intergenic
928768007 2:34670975-34670997 TGGGCTCTGTAGTCAGCAGGTGG - Intergenic
928862383 2:35874663-35874685 CGGGCTCTACAATCAGCAGGTGG + Intergenic
928908366 2:36392572-36392594 AGAGTTCTGCTAACAGCAGTTGG - Intronic
929210989 2:39356940-39356962 TCAGCTCTACAAACAGCCTGTGG - Intronic
930289271 2:49472833-49472855 TGGACTCTGCAAGCAGCACGTGG + Intergenic
930878220 2:56244100-56244122 AGGGCTCTACAATCAGCAGGTGG + Intronic
932648714 2:73532272-73532294 GGGGCTCTACAATCAGCAGGTGG + Intronic
933348902 2:81127833-81127855 GGGGCTCTACAATCAGCAGGTGG + Intergenic
933593356 2:84258051-84258073 TTAGCTGTAGAAACAGCAGGTGG - Intergenic
933997021 2:87677491-87677513 TGGGCTTTGCATAGAGCAGGTGG + Intergenic
935101506 2:100000018-100000040 TGGGATCTGCAAACAGCACCAGG + Intronic
936068380 2:109349145-109349167 CGAGCTCTGCACTCAGCAGATGG - Intronic
936287245 2:111190327-111190349 TGGGCTCTGTAAACAGCTGTTGG + Intergenic
936296828 2:111273419-111273441 TGGGCTTTGCATAGAGCAGGTGG - Intergenic
936703611 2:115042685-115042707 TGAGCTATTCAAAGAGCAGAGGG + Intronic
936940308 2:117878009-117878031 AGGGCTCTGCAATCAGCAGGTGG + Intergenic
938116404 2:128605656-128605678 TGGGATCAGCAGACAGCAGGTGG - Intergenic
940738571 2:157480797-157480819 TGTTCTCTGCAATCAGCAAGTGG - Intronic
941672495 2:168310132-168310154 AGGGCTCTGTAATCAGCAGGTGG + Intergenic
942326516 2:174781164-174781186 TGAGCTTGGAAAACAGCAGGAGG + Intergenic
942352418 2:175066057-175066079 GGAGCTCTAAAATCAGCAGGTGG - Intergenic
942986177 2:182145037-182145059 TGAGGTCTAAAAACAACAGGAGG - Intronic
943118867 2:183709748-183709770 GGGGCTCTACAATCAGCAGGTGG + Intergenic
944046260 2:195414701-195414723 AGGGCTCTACAATCAGCAGGTGG - Intergenic
944990437 2:205229692-205229714 AGAGCTCCGCAATAAGCAGGTGG + Intronic
945730080 2:213522629-213522651 TGGGGTGTGCAAACAGCAGATGG - Intronic
947307413 2:228762686-228762708 AGGGCTCTGCAGTCAGCAGGTGG - Intergenic
947312256 2:228817713-228817735 GGAGCTCTACAATCAGCAGGTGG + Intergenic
948320075 2:237062033-237062055 TCAGCTCTGTGACCAGCAGGTGG - Intergenic
949061983 2:241966238-241966260 TGAACTCTGCACACAGCGGTGGG - Intergenic
1169649832 20:7854721-7854743 TGAGCTGTCCAAACATCTGGAGG + Intergenic
1170086874 20:12544015-12544037 GGGGCTCTACAACCAGCAGGTGG + Intergenic
1170996093 20:21360319-21360341 AGAGCACTCCAAACAACAGGAGG - Intronic
1172194310 20:33081710-33081732 TGAACTCTGCTAGCAGGAGGAGG - Intronic
1172873270 20:38148778-38148800 TGAGCCCTGCAGAGAGCAGCGGG - Intronic
1173098999 20:40065961-40065983 GGAGGTCTACAATCAGCAGGTGG - Intergenic
1173142081 20:40493409-40493431 TTAGGTCTGCAAACACCTGGGGG + Intergenic
1174610029 20:51791147-51791169 GGAACTCGGCAAACAGCTGGGGG + Exonic
1174856423 20:54049765-54049787 GGAGCTCTAAAAACAGCAGCTGG - Intronic
1176044384 20:63084727-63084749 TGAGCTCTGCATGCAGCTGCCGG + Intergenic
1177456410 21:21344744-21344766 AGGGCTCTACAATCAGCAGGAGG - Intronic
1178216690 21:30606411-30606433 GGTGCTCTTCAATCAGCAGGTGG - Intergenic
1178398012 21:32259593-32259615 TGATCACTGAAAGCAGCAGGTGG + Intergenic
1179453322 21:41480326-41480348 TGAGCCCTATAACCAGCAGGTGG - Intronic
1179579555 21:42332437-42332459 TGACATCTGCTAACAGCAGGTGG - Intergenic
1179639722 21:42739255-42739277 AGAGGTCTGCAGACAGCAGCAGG - Intronic
1179652587 21:42821226-42821248 AGGGCTCTACAATCAGCAGGTGG - Intergenic
1179928602 21:44551992-44552014 TGATGTCTGCCAAGAGCAGGAGG + Intronic
1180021788 21:45133241-45133263 TGAGCTCTGCCAAGAGCCAGTGG - Intronic
1181167283 22:20990632-20990654 TGAGCTCTGCAAACAGCAGGAGG + Intronic
1181467273 22:23116963-23116985 TGAGCTCTCAGACCAGCAGGAGG + Intronic
1181539721 22:23566719-23566741 TGAGCTCTGCCAAGGGCCGGGGG + Intergenic
1181545578 22:23600265-23600287 TGAGGTTTGGAAGCAGCAGGTGG + Intergenic
1183164896 22:36140201-36140223 TGATGTCAGCAGACAGCAGGAGG - Intergenic
1183312636 22:37119114-37119136 TGAGCTCAGCAAGCAGGGGGTGG + Intergenic
1184223738 22:43117049-43117071 TTAGCTCTGAAAGCCGCAGGTGG + Intronic
1184313147 22:43661680-43661702 TGAGCTCTGCCTCCACCAGGAGG + Intronic
1185271498 22:49931377-49931399 TGACCACTGCAAAAGGCAGGTGG - Intergenic
1185379072 22:50498730-50498752 TGACCTCTGCAAACCTCCGGGGG + Intergenic
949250125 3:1973514-1973536 TGACCTCTGCAAACAGAAAAAGG + Intergenic
949807608 3:7973266-7973288 TGAGCTCTGCAAAGAACACCAGG + Intergenic
949937864 3:9130962-9130984 TGAGCCCGGCAAACTGCTGGAGG - Intronic
952566915 3:34669640-34669662 AGGGCTCTGCAGTCAGCAGGTGG - Intergenic
952912621 3:38203865-38203887 AGGGCTCTGCAATCAGCAGATGG + Intronic
953229294 3:41050384-41050406 AGGGCTCTACAATCAGCAGGTGG + Intergenic
953453694 3:43024970-43024992 TGAGCAATGGAAACAGGAGGAGG + Intronic
953722658 3:45369710-45369732 GGGGCTCTACAATCAGCAGGTGG - Intergenic
953919766 3:46943778-46943800 CTAGCTCTGCAGACAGCATGAGG + Intronic
957614089 3:82506032-82506054 TGAGGTATGCAAACAACTGGAGG - Intergenic
957907554 3:86577845-86577867 AGGGCTCTACAATCAGCAGGTGG + Intergenic
958757705 3:98270841-98270863 GGGGCTCTTCAATCAGCAGGTGG + Intergenic
958760232 3:98297507-98297529 AGAGCTTTACAAAGAGCAGGTGG - Intergenic
959113540 3:102149409-102149431 TGGGCTCTACAATCAGTAGGTGG - Intronic
959303989 3:104636319-104636341 GGGGCTCTACAATCAGCAGGTGG - Intergenic
959724932 3:109532766-109532788 GGGGCTCTACAATCAGCAGGTGG + Intergenic
960963762 3:123090557-123090579 TGAGATCTTCCAGCAGCAGGTGG + Intronic
961110234 3:124277369-124277391 TGAGCTCCGTCAACAGGAGGTGG - Intronic
961736640 3:129005822-129005844 TCAGCTATGCAAACAGGAAGTGG - Intronic
962015238 3:131432209-131432231 CGAGCTCTTCAGTCAGCAGGTGG - Intergenic
962078654 3:132114061-132114083 AGGGCTCTACAATCAGCAGGTGG + Intronic
962152024 3:132903168-132903190 GGGGCTCTACAATCAGCAGGTGG - Intergenic
962698926 3:137978467-137978489 GGGGCTCTACAATCAGCAGGTGG + Intergenic
962759037 3:138492215-138492237 AGAGTTCTACAATCAGCAGGTGG + Intergenic
963432051 3:145220007-145220029 TGAGCTCTGCAGAAACCATGAGG + Intergenic
964423823 3:156531862-156531884 GGGGCTCAGCACACAGCAGGTGG - Intronic
965118243 3:164519629-164519651 GGGGCTCTGTAATCAGCAGGTGG + Intergenic
965175161 3:165321921-165321943 AGAGCTCTACAATCAGCAGGTGG + Intergenic
965800166 3:172484285-172484307 TGAGCTATGCAGACATCTGGAGG + Intergenic
966453854 3:180093437-180093459 AGGGCTCTCCAATCAGCAGGTGG + Intergenic
967677567 3:192317695-192317717 AGGGCTCTGTAATCAGCAGGTGG - Intronic
968359684 3:198138343-198138365 TCATCACTGTAAACAGCAGGAGG - Intergenic
968572526 4:1349554-1349576 TCAGCTGTGCTATCAGCAGGCGG - Exonic
969149310 4:5155136-5155158 TGAGCCTTGCAAACACCTGGGGG - Intronic
969481760 4:7450109-7450131 TGGGCTCTGCAGACTGCATGTGG + Intronic
969527792 4:7712835-7712857 GGAGCTCTCCAACCTGCAGGTGG + Exonic
969578005 4:8047568-8047590 TCTACTTTGCAAACAGCAGGTGG - Intronic
970011079 4:11459825-11459847 AGGGCTCTACAATCAGCAGGTGG - Intergenic
970071134 4:12161593-12161615 GGGGCTCTACAACCAGCAGGTGG + Intergenic
970599084 4:17626792-17626814 TGTGTTCTACAAACAGCAGCTGG + Exonic
971322250 4:25615039-25615061 TGAGCTCTGCAAACTGTAACCGG - Intergenic
972272132 4:37522107-37522129 GGAGCTCTACAATCAGCTGGTGG + Intronic
972904542 4:43728631-43728653 TGGGCTCTACAATCAGCAGGTGG - Intergenic
974710927 4:65593819-65593841 TGATCTCTGAAAGCATCAGGAGG - Intronic
975252804 4:72198731-72198753 ACAGCTCTACAACCAGCAGGTGG - Intergenic
976171632 4:82310744-82310766 AGAGCTCTACAATCAGCAGGTGG + Intergenic
976728417 4:88239413-88239435 AGGGCTCTGCAATCAGCAGGTGG + Intergenic
977184967 4:93925507-93925529 GGGGCTCTACAATCAGCAGGTGG - Intergenic
977873604 4:102123428-102123450 AGGGCTCTACAATCAGCAGGTGG + Intergenic
978112501 4:104979172-104979194 AGAGCTCTACAATCAGCAGGGGG - Intergenic
978254678 4:106680216-106680238 TGAGCTGTAAACACAGCAGGAGG - Intergenic
978520432 4:109609803-109609825 AGAACTCTACAATCAGCAGGTGG + Intronic
978857022 4:113404925-113404947 TGAGCTCTCAAGACAGCAGCTGG - Intergenic
978934520 4:114359025-114359047 AGAGCTCTACAAACAGCAATGGG + Intergenic
979573077 4:122252767-122252789 AGAGCTGTACAATCAGCAGGTGG - Intronic
981027814 4:140094289-140094311 TGAGCTGTGCAAAGAGGAGCAGG + Intronic
981140317 4:141259956-141259978 AGAGCTCTACAATCAGCATGTGG - Intergenic
981298023 4:143155815-143155837 GGGGCTCTACAATCAGCAGGTGG + Intergenic
981895736 4:149796527-149796549 GGGGCTCTACAATCAGCAGGTGG - Intergenic
982088998 4:151864274-151864296 TGATACCTGCAAACAGGAGGGGG - Intergenic
982326889 4:154137348-154137370 TGAGCACTCCAAACAGGTGGTGG - Intergenic
982615381 4:157634229-157634251 AGGGCTCTACAATCAGCAGGTGG - Intergenic
982828213 4:160027026-160027048 TAGGCTCTACAATCAGCAGGTGG + Intergenic
982932775 4:161429329-161429351 TGGGCTCTACAATCAGCAGGTGG - Intronic
983931866 4:173461186-173461208 GGGGCTCTGCAATCTGCAGGTGG - Intergenic
984318592 4:178161463-178161485 TCAAGTCTGCACACAGCAGGAGG + Intergenic
986366723 5:7040316-7040338 GGTACTCTGCAAGCAGCAGGTGG - Intergenic
986612352 5:9582049-9582071 TGAGGTCAGGTAACAGCAGGGGG + Intergenic
986690075 5:10306951-10306973 TGGGCTTTGAAAACAACAGGTGG + Intronic
987616188 5:20277118-20277140 AGGGCTCTAAAAACAGCAGGTGG - Intronic
987903961 5:24051277-24051299 TGGCCTCTACAATCAGCAGGTGG - Intronic
988299568 5:29404541-29404563 GGAGCTCTACAATCAACAGGTGG - Intergenic
988795995 5:34654341-34654363 TAAGTTCTGCCAACTGCAGGGGG - Intergenic
989723009 5:44552354-44552376 GGGGCTCTGCAATCAGCTGGTGG + Intergenic
990023768 5:51160172-51160194 TGAGAGCTGCAGACAACAGGAGG + Intergenic
990607328 5:57423705-57423727 GGAGCTCGGCCAACAGCTGGGGG - Intergenic
991180517 5:63746303-63746325 GGAGCTCTACAATCAGCGGGAGG + Intergenic
994105266 5:95940954-95940976 AGAGCTCTGCAAAAAGAAGGGGG + Intronic
994235532 5:97358133-97358155 GGGGCTCTACAATCAGCAGGTGG + Intergenic
994530045 5:100957312-100957334 GGGGCTCTACAATCAGCAGGTGG - Intergenic
996133316 5:119808968-119808990 GGGGCTCTGCAATCAGTAGGTGG + Intergenic
996666640 5:126067185-126067207 AGGGCTCTACAATCAGCAGGTGG - Intergenic
996927624 5:128846615-128846637 GGGGCTCTACAATCAGCAGGTGG - Intronic
996962592 5:129269466-129269488 TGGCCTCTGCAACCAGCAGTTGG + Intergenic
997380587 5:133433767-133433789 TCAGCTCTGTAAAGAGCTGGGGG + Intronic
997657149 5:135563932-135563954 ACAGCTCTGCAGACAGCTGGGGG + Intergenic
998934840 5:147224109-147224131 TGTGATCTGCAAAGAGCAGAAGG + Intergenic
999002442 5:147939283-147939305 GGGGCTCTACAATCAGCAGGTGG + Intergenic
999151662 5:149430416-149430438 TGAGCCGTGCAGACAGCAGAGGG + Intergenic
999345729 5:150817390-150817412 GGGGCTCTACAATCAGCAGGTGG - Intergenic
999512890 5:152271252-152271274 GGAGGTTTGCAAACAGAAGGAGG - Intergenic
999849412 5:155522737-155522759 AGGGCTCTACAATCAGCAGGTGG + Intergenic
1000314082 5:160072187-160072209 ATAGCTCTGCACACAACAGGAGG - Intronic
1000399561 5:160811810-160811832 GGAGCTCTAAAATCAGCAGGTGG - Intronic
1001037510 5:168308128-168308150 TGAGCCTTGCAAGCAGGAGGTGG + Intronic
1001574393 5:172752531-172752553 TGACCACTGCAAACAACACGTGG - Intergenic
1002784745 6:392493-392515 TGGGCTCTGCAAACGACAAGTGG - Intronic
1003444897 6:6175369-6175391 TCAGCTCAGCAAACAGCAAGTGG - Intronic
1003952238 6:11127165-11127187 AGGGCTCTACAATCAGCAGGTGG + Intronic
1005886908 6:30103868-30103890 TGAGCTCTACATACAGCAGGAGG + Intronic
1006203788 6:32321226-32321248 TTAGCTATCCAAAAAGCAGGTGG + Intronic
1007902007 6:45421875-45421897 GGAGCTTTGCAAATTGCAGGAGG + Intronic
1008177532 6:48287633-48287655 GGGGCTCTACAAATAGCAGGTGG + Intergenic
1008227198 6:48935851-48935873 GGAGCTCTACAACCAGTAGGTGG + Intergenic
1008250275 6:49231605-49231627 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1008727502 6:54440787-54440809 GGGGCTCTGCAATCAGCAGGTGG + Intergenic
1009245529 6:61232203-61232225 GGGGCTCTGCAATCAACAGGTGG - Intergenic
1011019040 6:82789870-82789892 AGGGCTCTACAAACAACAGGTGG - Intergenic
1011024011 6:82846080-82846102 AGGGCTCTACAATCAGCAGGTGG - Intergenic
1012679025 6:102154613-102154635 GGGGCTCTACAATCAGCAGGTGG - Intergenic
1012724316 6:102789560-102789582 TGAGCACTGGAAAAAGTAGGGGG + Intergenic
1013369545 6:109456833-109456855 TGTGATCTGCACACAGCAAGTGG + Intergenic
1013543767 6:111135873-111135895 TCAGCTCTGCTCACAGCAGAGGG + Intronic
1014340199 6:120195942-120195964 TGACCTTTGCAAAGAGAAGGAGG + Intergenic
1014378900 6:120714115-120714137 TGGGCTCTACAATCAGCAGGTGG - Intergenic
1014862353 6:126485129-126485151 AGAGCTCTACAATCAGCAGATGG - Intergenic
1016229873 6:141789534-141789556 AGGGCTCTACAATCAGCAGGTGG - Intergenic
1016251648 6:142049656-142049678 TGGGCTCTACAATCAGCAGGTGG - Intergenic
1017246911 6:152236897-152236919 GGAGCTCAGCAGACAGCTGGAGG - Exonic
1017398094 6:154027506-154027528 GGGGCTCTTCAATCAGCAGGTGG + Intronic
1020624306 7:10558630-10558652 AGGGCTCTACAATCAGCAGGTGG - Intergenic
1021034882 7:15785413-15785435 GGGGCTCTACAATCAGCAGGGGG - Intergenic
1021046714 7:15931705-15931727 TGAGCTTTGCAAACAAAATGGGG - Intergenic
1021203422 7:17752434-17752456 GGGGCTCTTCAATCAGCAGGTGG + Intergenic
1021382322 7:19983330-19983352 GGAGCTCTACAATCAGCATGAGG + Intergenic
1021750545 7:23795192-23795214 TGAAGGCTGCACACAGCAGGGGG - Intronic
1022487359 7:30790004-30790026 TGACCTCTGCCATCAGGAGGGGG + Intronic
1022562295 7:31362424-31362446 TGAGCTCAGTAATCAGCTGGAGG + Intergenic
1023506061 7:40900694-40900716 TGTGCTCTGCAAAAACCACGAGG + Intergenic
1023913521 7:44571625-44571647 TGAGCAGGGCATACAGCAGGAGG + Exonic
1024369028 7:48559060-48559082 AGGGCTCTACAATCAGCAGGTGG + Intronic
1024410926 7:49039814-49039836 GGAGCTCTGAAATCAGCAGGTGG - Intergenic
1024610937 7:51063568-51063590 AGAGGTCTGCAGACAGCAGTAGG + Intronic
1025027167 7:55526109-55526131 TGAGCTCTTCAAGAAGCATGTGG - Intronic
1026550257 7:71362412-71362434 GGAGATCTGCACACAGCAGGCGG - Intronic
1027595847 7:80173161-80173183 TGAACCCTGCAGTCAGCAGGAGG - Intronic
1027604965 7:80288588-80288610 AGGGCTCTACAATCAGCAGGGGG - Intergenic
1027674795 7:81143800-81143822 AGAGCTCTACAATCAGCAAGTGG - Intergenic
1027771367 7:82410667-82410689 AGAGCTCTGCTAGCAGCAGTTGG - Intronic
1027911871 7:84261274-84261296 TGAGGTATGCAGACAGCTGGAGG - Intronic
1028264375 7:88705169-88705191 TGGGCTCTACCATCAGCAGGTGG + Intergenic
1029797217 7:102908927-102908949 GGGGCTCTACAATCAGCAGGTGG + Intronic
1030499654 7:110343597-110343619 TGAATTCTGCAAACAACTGGAGG - Intergenic
1031231536 7:119114012-119114034 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1031639033 7:124139799-124139821 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1031657915 7:124380727-124380749 GGGGCTCTACAATCAGCAGGTGG - Intergenic
1031758691 7:125682072-125682094 TGGGCTCTACAATAAGCAGGTGG - Intergenic
1032403725 7:131641097-131641119 TGAACGCTGCAAAAGGCAGGGGG - Intergenic
1032916907 7:136501290-136501312 TGAGCTCAGCAAGAAGCAGATGG - Intergenic
1033372484 7:140723138-140723160 TGAGGTTTGCAAGCAGCTGGCGG + Intronic
1033833538 7:145282320-145282342 GGAGCTCTGAAATCATCAGGTGG + Intergenic
1035219781 7:157399481-157399503 TGAGCGCTGCAAGCAGCTGTAGG - Intronic
1035550894 8:523914-523936 AGGGCTCTACAATCAGCAGGTGG - Intronic
1036478761 8:9119072-9119094 CTAGCTCAGCAAACAACAGGAGG + Intergenic
1037194765 8:16175211-16175233 TGAGAACTGCAAACACGAGGAGG + Exonic
1037666348 8:20973309-20973331 TGAGCTTTGCAAACTGCCAGGGG - Intergenic
1037670514 8:21011532-21011554 AGAGCACAGCAAAGAGCAGGTGG - Intergenic
1038036630 8:23691652-23691674 TGAGCTGTGAAAACACCAGGAGG - Intergenic
1039325178 8:36477413-36477435 AGAGCACTGCAAACACCAGAAGG - Intergenic
1039507445 8:38062136-38062158 GCTGCTCTCCAAACAGCAGGTGG - Intergenic
1041500317 8:58533034-58533056 AGAGCTCTACAATCAGCAAGTGG + Intergenic
1043340194 8:79229127-79229149 GGAGCTCTACAATCAGCATGTGG + Intergenic
1043803663 8:84643666-84643688 TGGGCTCTGCAAGCAGCAAGTGG - Intronic
1043982614 8:86658876-86658898 TGAGCTCTGGGAGGAGCAGGTGG - Intronic
1044431232 8:92109633-92109655 GGAGCTCTGCATATAGAAGGAGG - Intergenic
1045207181 8:100055120-100055142 TGGGCTCTACAATTAGCAGGTGG - Intronic
1047318313 8:123754720-123754742 TGAGGTATGCAAACAACTGGAGG + Intergenic
1047841246 8:128755307-128755329 AGAGCTCTACAGTCAGCAGGTGG - Intergenic
1047901182 8:129423668-129423690 AGTGCTCTACAATCAGCAGGTGG - Intergenic
1047910191 8:129519121-129519143 GGGGCTCTACAATCAGCAGGTGG - Intergenic
1048706144 8:137155737-137155759 AGTGCTCTACAATCAGCAGGTGG + Intergenic
1048885222 8:138904148-138904170 TGAGCTCTGCAATGAGGTGGCGG - Intronic
1048997318 8:139801989-139802011 TGAGCTCTGCTAAGAGCACCTGG - Intronic
1049214550 8:141401757-141401779 GGAGCTCAGAGAACAGCAGGTGG + Intronic
1049271928 8:141700606-141700628 GCAGCTCTGCTGACAGCAGGAGG - Intergenic
1049954843 9:683051-683073 TGATCTCAGAAAACACCAGGTGG - Intronic
1050072508 9:1830705-1830727 AGACCTCTGCACACAGCAGCTGG + Intergenic
1053201055 9:36151776-36151798 TGAGCCCAGCAAAAGGCAGGGGG - Intronic
1053359413 9:37473552-37473574 TGGGCTTTGCAAACTGCAAGTGG + Intergenic
1055073777 9:72193671-72193693 GGGGCTCTACAATCAGCAGGTGG + Intronic
1055387348 9:75776421-75776443 ATGGCTCTGCAATCAGCAGGTGG - Intergenic
1055827097 9:80339771-80339793 AGAGCTCTACAATCAGCAGGTGG - Intergenic
1055984054 9:82037483-82037505 GCAGCTTTGCAAACAACAGGAGG + Intergenic
1056424602 9:86464501-86464523 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1058780249 9:108325792-108325814 GGAGCGCTGCAATCAGCAGATGG - Intergenic
1058820984 9:108728961-108728983 AGAGCTCTGCACTGAGCAGGTGG - Intergenic
1060576352 9:124699146-124699168 AGCGCTCTGCAAACAGCACAAGG + Intronic
1061275881 9:129569183-129569205 TGAGCTCTGCCAAGGGCCGGGGG + Intergenic
1061308429 9:129746281-129746303 TGAGCTGTCCAGGCAGCAGGAGG - Intronic
1062350657 9:136137125-136137147 TGGGCTCTGCAAAGTGGAGGTGG - Intergenic
1062744390 9:138202164-138202186 TCATCACTGTAAACAGCAGGAGG - Intergenic
1188644455 X:32547753-32547775 TGAGCTCTGTAATAATCAGGAGG - Intronic
1188715701 X:33456955-33456977 TGGGCTCTACAATCAGCAGATGG - Intergenic
1189769977 X:44416223-44416245 TGGCCTCTACAATCAGCAGGTGG + Intergenic
1189858366 X:45247277-45247299 GGGGCTCTGCAATCAGAAGGTGG + Intergenic
1190046346 X:47114089-47114111 AGAGCTCTACAATGAGCAGGTGG - Intergenic
1190368204 X:49717146-49717168 AGGGCTCTACAATCAGCAGGTGG + Intergenic
1190808254 X:53860390-53860412 AGGGCTCTACAATCAGCAGGCGG + Intergenic
1190893797 X:54596584-54596606 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1191910231 X:66142594-66142616 GGGGCTCTGCAACAAGCAGGTGG + Intergenic
1192304345 X:69943703-69943725 AGGGCTCTACAATCAGCAGGTGG + Intronic
1192380886 X:70614622-70614644 AGGGCTCTGCAATCAGCAAGTGG - Intronic
1192406114 X:70887687-70887709 AGAGCTCTACAACCAGCAGGTGG - Intronic
1192822333 X:74658163-74658185 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1192839096 X:74835794-74835816 TGGGCTCTACAACCAGCAGGTGG + Intronic
1192941017 X:75911896-75911918 TGGGCTCTACAGTCAGCAGGTGG + Intergenic
1193191785 X:78579440-78579462 GGAGCTCTGCAATCATCATGTGG + Intergenic
1193210071 X:78797151-78797173 AGGCCTCTGCAATCAGCAGGGGG + Intergenic
1193337309 X:80306286-80306308 GGAGCTCTACAATCAGCAGTTGG + Intergenic
1193957854 X:87885303-87885325 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1194037001 X:88887144-88887166 AAGGCTCTGCAATCAGCAGGTGG + Intergenic
1194095958 X:89638679-89638701 AGGGCTCTGCAGTCAGCAGGTGG - Intergenic
1194288451 X:92039244-92039266 AGGGCTCTACAATCAGCAGGTGG + Intronic
1194506693 X:94742749-94742771 GGAGCTCTACAATCACCAGGTGG + Intergenic
1194546461 X:95240384-95240406 GGAGTTCTGTAATCAGCAGGTGG - Intergenic
1194889898 X:99365171-99365193 GCAGCTCTGCAATCAGCAGGTGG - Intergenic
1194925386 X:99817673-99817695 TGGGCTCTACAATCATCAGGGGG - Intergenic
1195199984 X:102539409-102539431 AGAGCTCTACAATCAGCAGATGG + Intergenic
1195372234 X:104188179-104188201 TCAGTTCTGCAAGCAGCAGTGGG + Exonic
1196045564 X:111252751-111252773 TGTGATCTGCAGATAGCAGGAGG + Intronic
1196247475 X:113416221-113416243 GGGGCTCTATAAACAGCAGGTGG - Intergenic
1196573375 X:117289247-117289269 TGGGCTCTACAAAGAGCAGGTGG - Intergenic
1196600847 X:117600343-117600365 GGGGCTCTACAATCAGCAGGGGG + Intergenic
1196865448 X:120066583-120066605 TGGGCTCTACAATGAGCAGGTGG - Intergenic
1196877646 X:120169697-120169719 TGGGCTCTACAATGAGCAGGTGG + Intergenic
1197661447 X:129178461-129178483 TGGGCTTTACAATCAGCAGGTGG + Intergenic
1197987059 X:132278163-132278185 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1198773639 X:140156446-140156468 AGGGCTCTACAATCAGCAGGTGG - Intergenic
1198982027 X:142408931-142408953 TGGGCTCTACAATCAGCTGGTGG - Intergenic
1199069656 X:143461618-143461640 TGATCTTTGCAAAATGCAGGAGG - Intergenic
1199156218 X:144551643-144551665 GGGGCTCTGCAATCAGCAGCTGG - Intergenic
1199163828 X:144647254-144647276 GGGGCTCTACAATCAGCAGGTGG + Intergenic
1199191901 X:144980763-144980785 TGGGCTCTACAATCAGCAGGTGG - Intergenic
1199274714 X:145927099-145927121 GGGGCTCTACAATCAGCAGGTGG - Intergenic
1199317251 X:146395331-146395353 GGAGCTCTACAATGAGCAGGTGG + Intergenic
1199358389 X:146887216-146887238 TGGGCTCTGCAATCAGCAGGTGG - Intergenic
1199455107 X:148019936-148019958 GGGACTCTACAAACAGCAGGTGG + Intronic
1199535023 X:148892943-148892965 AGAGCTCTAGAAACAGCAGATGG + Intronic
1199645844 X:149909841-149909863 AGGGCTCTACAATCAGCAGGTGG - Intergenic
1199845361 X:151688827-151688849 AGGACTCTGCAATCAGCAGGTGG - Intergenic
1200053099 X:153445037-153445059 GCAGCTCGGCACACAGCAGGGGG + Exonic
1200448962 Y:3300062-3300084 AGGGCTCTGCAGTCAGCAGGTGG - Intergenic
1200457858 Y:3414729-3414751 TGAGCTCTGGTAACAAGAGGAGG - Intergenic
1200605972 Y:5263809-5263831 AGGGCTCTACAATCAGCAGGTGG + Intronic
1201762499 Y:17555401-17555423 TGGTCTCTGCAATTAGCAGGTGG - Intergenic
1201839053 Y:18350587-18350609 TGGTCTCTGCAATTAGCAGGTGG + Intergenic