ID: 1181167963

View in Genome Browser
Species Human (GRCh38)
Location 22:20993379-20993401
Sequence CAGAGCTCTGCTGAGGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181167959_1181167963 -4 Left 1181167959 22:20993360-20993382 CCAGGCAGAGTGGAGACGGCAGA 0: 1
1: 0
2: 2
3: 25
4: 270
Right 1181167963 22:20993379-20993401 CAGAGCTCTGCTGAGGCCTGGGG No data
1181167955_1181167963 15 Left 1181167955 22:20993341-20993363 CCAGTGTGAGGACGCAGGTCCAG No data
Right 1181167963 22:20993379-20993401 CAGAGCTCTGCTGAGGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181167963 Original CRISPR CAGAGCTCTGCTGAGGCCTG GGG Intronic
No off target data available for this crispr