ID: 1181168037

View in Genome Browser
Species Human (GRCh38)
Location 22:20993684-20993706
Sequence CGCTGCACGAGGACTACGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 31}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181168028_1181168037 11 Left 1181168028 22:20993650-20993672 CCCCTCTTGCAGTTCTCCTGTTA 0: 1
1: 0
2: 3
3: 26
4: 266
Right 1181168037 22:20993684-20993706 CGCTGCACGAGGACTACGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 31
1181168029_1181168037 10 Left 1181168029 22:20993651-20993673 CCCTCTTGCAGTTCTCCTGTTAC 0: 1
1: 0
2: 1
3: 33
4: 394
Right 1181168037 22:20993684-20993706 CGCTGCACGAGGACTACGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 31
1181168031_1181168037 -5 Left 1181168031 22:20993666-20993688 CCTGTTACCCTAAATGCACGCTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1181168037 22:20993684-20993706 CGCTGCACGAGGACTACGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 31
1181168030_1181168037 9 Left 1181168030 22:20993652-20993674 CCTCTTGCAGTTCTCCTGTTACC 0: 1
1: 0
2: 0
3: 21
4: 315
Right 1181168037 22:20993684-20993706 CGCTGCACGAGGACTACGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181168037 Original CRISPR CGCTGCACGAGGACTACGGG CGG Exonic