ID: 1181170822

View in Genome Browser
Species Human (GRCh38)
Location 22:21008895-21008917
Sequence CCATGTACTTGCCATGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 2, 2: 4, 3: 12, 4: 136}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181170816_1181170822 0 Left 1181170816 22:21008872-21008894 CCCTCTGTACAACATGCAGCAGG 0: 1
1: 4
2: 0
3: 13
4: 177
Right 1181170822 22:21008895-21008917 CCATGTACTTGCCATGGTGAGGG 0: 1
1: 2
2: 4
3: 12
4: 136
1181170815_1181170822 1 Left 1181170815 22:21008871-21008893 CCCCTCTGTACAACATGCAGCAG 0: 1
1: 4
2: 1
3: 10
4: 135
Right 1181170822 22:21008895-21008917 CCATGTACTTGCCATGGTGAGGG 0: 1
1: 2
2: 4
3: 12
4: 136
1181170818_1181170822 -1 Left 1181170818 22:21008873-21008895 CCTCTGTACAACATGCAGCAGGC No data
Right 1181170822 22:21008895-21008917 CCATGTACTTGCCATGGTGAGGG 0: 1
1: 2
2: 4
3: 12
4: 136
1181170814_1181170822 7 Left 1181170814 22:21008865-21008887 CCACATCCCCTCTGTACAACATG 0: 1
1: 2
2: 5
3: 13
4: 161
Right 1181170822 22:21008895-21008917 CCATGTACTTGCCATGGTGAGGG 0: 1
1: 2
2: 4
3: 12
4: 136
1181170813_1181170822 28 Left 1181170813 22:21008844-21008866 CCGCACTGACATCTTTCAGGACC 0: 1
1: 1
2: 2
3: 26
4: 201
Right 1181170822 22:21008895-21008917 CCATGTACTTGCCATGGTGAGGG 0: 1
1: 2
2: 4
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181170822 Original CRISPR CCATGTACTTGCCATGGTGA GGG Intergenic
902730337 1:18364846-18364868 CCAGGTGGTTGCCATGGTGTAGG + Intronic
903239012 1:21970171-21970193 CCATCTACAAGCCAAGGTGAGGG - Intergenic
903242921 1:21995847-21995869 CCATCTACAAGCCAAGGTGAGGG - Intronic
903472396 1:23596335-23596357 CACTGAACTTCCCATGGTGAAGG - Intronic
904886093 1:33739444-33739466 CCAAGAACTTGCCATGTTGGCGG + Intronic
911124246 1:94325555-94325577 CCATGGAGTGGCCATGGTGTGGG + Intergenic
916892035 1:169121459-169121481 CCGTGGACTTGACATTGTGAAGG + Intronic
918244542 1:182647238-182647260 CCCTTTGCCTGCCATGGTGAAGG - Intronic
920009223 1:202855665-202855687 CCATGTACTTGCCGTGGCGAGGG + Intergenic
920086121 1:203418584-203418606 CCCTGCACTGGCCATGGTGGTGG - Intergenic
921610977 1:217212012-217212034 CCATTTACCTGTCATGGTGAAGG - Intergenic
924190365 1:241545471-241545493 CCATCTACAAGCCATGGAGAGGG - Intronic
1063068627 10:2636558-2636580 AAATGTAATTGCCATTGTGATGG + Intergenic
1065333380 10:24627935-24627957 CCCTTTCCTTGCCAAGGTGAAGG - Intronic
1065412907 10:25450038-25450060 CCATGTATTAGCCAAGGTGGTGG - Intronic
1072127094 10:92456365-92456387 CCATGTTCTTGCCAGGGAAATGG - Exonic
1072418181 10:95266417-95266439 CCTAGGAATTGCCATGGTGATGG - Intronic
1074316354 10:112364857-112364879 CCATGAAGTTCCCATGGTGCAGG - Intergenic
1076745067 10:132508883-132508905 CCCTGGACTTGCCATGGAGAAGG - Intergenic
1080980266 11:37394707-37394729 CCATCTAGGTGCCATAGTGAAGG - Intergenic
1082106529 11:48227520-48227542 CCGTGTACTGGCCATGGAGGTGG + Intergenic
1083495400 11:63047698-63047720 CCATGTACTTGCTATGCCGGGGG - Intergenic
1086734024 11:90283572-90283594 CCATGTATTTACCATGGCGAGGG - Intergenic
1088166090 11:106939430-106939452 CTATGGACTTGAGATGGTGATGG - Intronic
1089390728 11:118099832-118099854 TCAGGTACTGGCCATGGTGAAGG - Intronic
1094751692 12:33416940-33416962 CCATATACTTGCCTTCCTGATGG - Intronic
1095048365 12:37534674-37534696 CCTTGTACTTGCCTTTGTCATGG + Intergenic
1096127162 12:49128374-49128396 CCATGTATTTACCATGGCGAGGG + Exonic
1096134115 12:49185426-49185448 CCATGTATTTACCATGGCGAGGG + Exonic
1096145024 12:49272795-49272817 CCATGTATTTACCATGGCGAGGG - Exonic
1100671679 12:96820026-96820048 CCTCCTACTTGCCATGGTGTGGG + Intronic
1102503396 12:113368448-113368470 GCTTGTTCTTCCCATGGTGATGG + Intronic
1102617155 12:114164671-114164693 TCATGTTCTTCCCATTGTGATGG + Intergenic
1105307153 13:19177043-19177065 CCATGTACTTGCCGTGGCGAGGG + Exonic
1106195481 13:27490770-27490792 AAATGTAATTGCCATTGTGATGG + Intergenic
1106388255 13:29309145-29309167 CCATGTCTTTGCTATTGTGAAGG - Intronic
1117378685 14:55138389-55138411 TCATGTACTTGACATGCAGAGGG + Intronic
1118837439 14:69486762-69486784 CAATGTACCTGCAGTGGTGAAGG - Intronic
1119030876 14:71191710-71191732 AAATGTAATTGCCATTGTGATGG - Intergenic
1119413911 14:74456907-74456929 CCTAGAACTAGCCATGGTGAAGG + Intergenic
1119546475 14:75475465-75475487 CCATGTAAGTGCCATGAGGATGG + Intergenic
1119934835 14:78582452-78582474 AAATGTAATTGCCATTGTGATGG + Intronic
1122133404 14:99619110-99619132 CCGTGTACTGGCCCTGGTGCTGG + Intergenic
1122311883 14:100802634-100802656 CCCTGTCCTGACCATGGTGATGG + Intergenic
1122997697 14:105274469-105274491 GCATGCCCTTACCATGGTGAAGG - Intronic
1123112028 14:105876571-105876593 CTTTCTACTTGCCATGATGAAGG + Intergenic
1123219982 14:106845592-106845614 CCAGCTACATGCCATGGTGGGGG - Intergenic
1124825654 15:33092536-33092558 CCATGTTCGTCTCATGGTGAGGG - Intronic
1125217121 15:37287891-37287913 CCATGTGCATGCAATTGTGAAGG + Intergenic
1126992535 15:54397650-54397672 GCATGTACATGCCATGTTAATGG - Intronic
1127375022 15:58376436-58376458 CCATCTACAAGCCATGGAGAGGG + Intronic
1128407743 15:67360399-67360421 GCATGTACTTGCCATATTGTGGG - Intronic
1128560950 15:68667355-68667377 CCATGTCCTTGCCATGTTTGAGG + Intronic
1137465641 16:48706424-48706446 GAATGTACTTCTCATGGTGATGG + Intergenic
1139507954 16:67408943-67408965 CAAAGTAATTGCCCTGGTGATGG - Intronic
1143395182 17:6588965-6588987 CCAAGAACATGCCATGGTCATGG + Intronic
1145834430 17:27943558-27943580 CCATTTAATTGCCATTGTGATGG + Intergenic
1149548772 17:57524137-57524159 GCATGCCCTTGTCATGGTGATGG + Intronic
1150159260 17:62881136-62881158 AAATGTAATTGCCATTGTGATGG - Intergenic
1150511584 17:65758075-65758097 CCAGCTACTTGCGATGCTGAGGG - Intronic
1151322562 17:73360588-73360610 CCAGGCATTTGCCATGGTCAAGG - Intronic
1152293794 17:79455129-79455151 CCATGTACATCCCATGGAGGGGG - Intronic
1153760730 18:8329532-8329554 CCATGTACTTTCCAAAGTGCTGG + Intronic
1153789898 18:8568876-8568898 CCAGGTACTTGGGAGGGTGAGGG + Intergenic
1157535428 18:48453852-48453874 CCATGCCGTGGCCATGGTGATGG + Intergenic
1158835591 18:61328087-61328109 CGATGTCCTTGCCATGGGCAAGG - Intergenic
1159707812 18:71715289-71715311 CCATGTGCTTGAAATGTTGAAGG - Intergenic
1160941513 19:1622305-1622327 CCATGTACCTGCCACGTAGAAGG + Exonic
1161651528 19:5488637-5488659 CTGTGTACTTGCCATCGTGGGGG + Intergenic
1164810763 19:31154095-31154117 GCATGTTCTTTTCATGGTGATGG - Intergenic
1167160918 19:47766526-47766548 CCATGTGTCTGCCATGGTGGGGG + Intergenic
1167657161 19:50772323-50772345 CCAGGTACTAGGCAGGGTGAGGG - Intergenic
1168366952 19:55796493-55796515 CCATGTGGTTTCCAGGGTGATGG + Intronic
928859469 2:35839462-35839484 CCTTGTCCTTGCAATGGTGCAGG + Intergenic
929966022 2:46537292-46537314 CCAACTCCTTGCCATAGTGATGG + Intronic
932048906 2:68379855-68379877 TAATGTAATTGCCATGGAGAAGG + Intronic
932856207 2:75236356-75236378 CCATGTCATTGCTATTGTGAAGG + Intergenic
933005508 2:76988439-76988461 CCATAAAGTTGCCATGGTGATGG + Intronic
938298538 2:130193902-130193924 CCATGTACTTGCCATGGCGAGGG + Exonic
938458192 2:131480611-131480633 CCATGTACTTGCCGTGGCGAGGG - Exonic
940018717 2:149134153-149134175 CCATGTACTTGAGCTGGAGAAGG + Intronic
940153254 2:150626206-150626228 AAATGTAATTGCCATTGTGATGG + Intergenic
942004712 2:171686432-171686454 CCATGTGCCAGCAATGGTGATGG - Intergenic
945718208 2:213384621-213384643 GTATGTACTTGCTATGGTGTAGG + Intronic
946635156 2:221716911-221716933 TCAGGTACTTGCACTGGTGATGG + Intergenic
948557521 2:238823766-238823788 CCAGGTCCTTGCCATGGAAAGGG - Intergenic
948797058 2:240410868-240410890 CCTTGCACCTGCCATGGTGGGGG - Intergenic
1174912738 20:54624230-54624252 CCAAGCACATGCCAGGGTGAAGG - Intronic
1176019143 20:62953681-62953703 CCATTACCTTGCCATGGTCAGGG - Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1177854675 21:26387438-26387460 GAATTTACCTGCCATGGTGATGG + Intergenic
1179326285 21:40349020-40349042 CCATGTACTTGGGAGGCTGAGGG + Intronic
1180187042 21:46145228-46145250 CCAAGCACTTGCCGGGGTGAGGG + Intronic
1180751393 22:18126896-18126918 CCATGTACTTGCCATGTCTCGGG - Exonic
1181170822 22:21008895-21008917 CCATGTACTTGCCATGGTGAGGG + Intergenic
1181180945 22:21067938-21067960 CTATGTACTTGCCATGGTGAGGG - Intergenic
1184194826 22:42920394-42920416 ACATGTTTTTGCCATTGTGATGG - Intronic
950849964 3:16052805-16052827 CCATGTACTTCCCAAGGAGGTGG - Intergenic
954967590 3:54625028-54625050 CCATGCACTTGGCATCCTGATGG + Intronic
956078755 3:65534906-65534928 CAAATTACCTGCCATGGTGATGG - Intronic
956771509 3:72530006-72530028 CCATGTGCAAGACATGGTGAAGG - Intergenic
956793084 3:72694968-72694990 CCACGGACTTGCCAGGGGGAGGG - Intergenic
959206807 3:103318666-103318688 CCATGTACTTGGGAGGCTGAGGG + Intergenic
962216875 3:133530180-133530202 CCATATTCTTCTCATGGTGATGG + Intergenic
962873706 3:139519632-139519654 CCATGTGCTGGGCATGCTGAAGG + Intronic
968709411 4:2102155-2102177 GCATGCACCTGCCTTGGTGAAGG - Intronic
970159670 4:13176080-13176102 CCATGTACCTGCCCTGGTACAGG - Intergenic
970434271 4:16018292-16018314 GCATGAGCTTGCCATGGTCAAGG - Intronic
974400743 4:61402996-61403018 CCATGTACAAGCCAGGATGAGGG - Intronic
974691753 4:65305750-65305772 CCAAGTACTTCCCATTGTGGAGG - Intergenic
979476721 4:121167157-121167179 CCCTGTACTTGACATTGTGTGGG + Intronic
987494077 5:18620106-18620128 CCATTTCCTGGCCATTGTGATGG - Intergenic
989362715 5:40622129-40622151 TCATCTACTTACCATGGTGGTGG - Intergenic
990511396 5:56492501-56492523 CCCTGTTGTTGCCATAGTGATGG + Intergenic
995950961 5:117713495-117713517 CCATCTAGGTGCCATAGTGAAGG + Intergenic
996119318 5:119652930-119652952 CCATGTATTTACCATGGTGAGGG + Intergenic
1001927187 5:175646527-175646549 ACATTTAATTGCCATTGTGATGG - Intergenic
1005911633 6:30315245-30315267 CACTTTCCTTGCCATGGTGAGGG - Intergenic
1006437095 6:34031335-34031357 TCATGTGCTCCCCATGGTGAAGG + Intronic
1009197341 6:60702805-60702827 TCATGTTCTTCTCATGGTGATGG + Intergenic
1011811619 6:91138715-91138737 AAATGTAATTGCCATTGTGATGG + Intergenic
1012137155 6:95572583-95572605 CCAAGTACTTGCCCAGGTGATGG - Intergenic
1012342517 6:98144280-98144302 CGCTGTACTTGTGATGGTGAGGG - Intergenic
1014687877 6:124526341-124526363 CCATGTAGTTGCTATGTGGAAGG - Intronic
1014690391 6:124556347-124556369 AAATGTAATTGCCATTGTGATGG + Intronic
1015590625 6:134819425-134819447 TCTTCTATTTGCCATGGTGATGG - Intergenic
1017125518 6:151060690-151060712 CCATGCAGTGGCCATGGTAAAGG - Intronic
1017991159 6:159490895-159490917 CCATGTACCTGCCAGGAGGAGGG + Intergenic
1018327059 6:162682325-162682347 CCATGTCTTTGCTATTGTGAAGG - Intronic
1023478365 7:40605555-40605577 CTATGTACCTGCCATTGTGTAGG + Intronic
1025260484 7:57414675-57414697 GCATGTGCTTGCCCTGGAGAAGG + Intergenic
1026950169 7:74341559-74341581 CCCTGCCCTGGCCATGGTGAGGG + Intronic
1029388026 7:100256503-100256525 CCATGTAGTTCACATGGCGAGGG + Intronic
1029902227 7:104053631-104053653 CCATGAAGATGCCATGCTGAGGG + Intergenic
1030823675 7:114127332-114127354 ACAGGTCCTTGCCATGGTCAAGG + Intronic
1034029432 7:147743844-147743866 TCCTGTCTTTGCCATGGTGATGG + Intronic
1036521484 8:9495412-9495434 CCATGTACAAGCCAAGGAGATGG + Intergenic
1039596600 8:38795796-38795818 TCATGTACATGCAAAGGTGAGGG - Intronic
1041638486 8:60171193-60171215 AAATGTAATTGCCATGGTGGTGG + Intergenic
1044412759 8:91902230-91902252 CCAGGTACTTGGGAGGGTGAGGG + Intergenic
1045351724 8:101347222-101347244 CCATGTACTTACCATAGAGGAGG - Intergenic
1045721528 8:105116725-105116747 CCATGTACATGGCATGGTGTTGG - Intronic
1047172355 8:122506135-122506157 CCATGCTTCTGCCATGGTGAAGG + Intergenic
1057735826 9:97659025-97659047 ACGTGTATTTGTCATGGTGATGG + Intronic
1061547994 9:131315788-131315810 CCCTGTAGTTGCTATGGAGATGG - Intergenic
1062634955 9:137485844-137485866 CCATGTCCTTGCCACTGTGCTGG - Intronic
1186150208 X:6666538-6666560 CCAGGTACTTGGGATGCTGAGGG - Intergenic
1187382729 X:18819787-18819809 CCATATATTTGACATGGTAATGG + Intronic
1189743799 X:44149262-44149284 CCATGTTCTTTTCATGGTGATGG - Intronic
1192172247 X:68864087-68864109 CCATGTACCTAACATTGTGATGG + Intergenic
1192436370 X:71145854-71145876 CCCTGGAGTTGCCATGGAGACGG + Intronic
1194056650 X:89143273-89143295 ACATATTCTTGTCATGGTGAAGG - Intergenic
1196411461 X:115424463-115424485 CCATGTATTTACCATAGTAAGGG + Intergenic
1202340626 Y:23861205-23861227 CCATCTACTTTCCAAGGTGTGGG + Intergenic
1202530140 Y:25808877-25808899 CCATCTACTTTCCAAGGTGTGGG - Intergenic