ID: 1181171687

View in Genome Browser
Species Human (GRCh38)
Location 22:21013622-21013644
Sequence TAGCTAATCCTGCCAGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181171685_1181171687 20 Left 1181171685 22:21013579-21013601 CCTGGCTCTAATAAATGAATACA 0: 1
1: 0
2: 5
3: 179
4: 3786
Right 1181171687 22:21013622-21013644 TAGCTAATCCTGCCAGAGTCAGG 0: 2
1: 0
2: 0
3: 8
4: 83
1181171684_1181171687 21 Left 1181171684 22:21013578-21013600 CCCTGGCTCTAATAAATGAATAC No data
Right 1181171687 22:21013622-21013644 TAGCTAATCCTGCCAGAGTCAGG 0: 2
1: 0
2: 0
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181171687 Original CRISPR TAGCTAATCCTGCCAGAGTC AGG Intronic
903540038 1:24091709-24091731 TAGCTAATGCTGCCACGGACAGG - Intronic
903667296 1:25015861-25015883 CATCTAATCCTCCCAGAGTCAGG - Intergenic
907760018 1:57348607-57348629 TCACTCATCTTGCCAGAGTCAGG + Intronic
908751987 1:67432388-67432410 TAACTACTCCTGCCACAATCTGG + Intergenic
909470889 1:76027085-76027107 TACCTAATCCTGGCATGGTCAGG - Intergenic
912687365 1:111778025-111778047 TGGCTAAGGCTGCCAGAGTGAGG + Intronic
913514580 1:119593074-119593096 TATCTGACCCTGTCAGAGTCAGG + Intergenic
916330255 1:163608025-163608047 TAGCCAACCCTCCCAGTGTCTGG - Intergenic
916500643 1:165384054-165384076 CAGCTAATGCTGCCAGTGTCAGG - Intergenic
917641874 1:176990680-176990702 TAGGTAATCCCCCCAGAGACTGG + Intronic
1066077065 10:31889271-31889293 TAGCTAATACTGCCAGGTTCTGG - Intronic
1073336770 10:102715343-102715365 TAGCAAAACCGGCCAGAGGCTGG - Intronic
1077982451 11:7314322-7314344 TACCTACTGCTGTCAGAGTCAGG - Intronic
1084921920 11:72477860-72477882 GACCTAATTCTGCCAGAATCTGG - Intergenic
1085380726 11:76115563-76115585 TAGCAAACCCTACCAGGGTCTGG + Intronic
1088846730 11:113674415-113674437 TTGCTATTCCTTTCAGAGTCTGG - Intergenic
1094124686 12:27011528-27011550 TAGCTCATCCTGCCAAAGATGGG + Intronic
1094496829 12:30993995-30994017 CAGCTAATCCTGCCCCAGTCAGG - Exonic
1097536132 12:60872892-60872914 CAGGTTATCCTGCCAGAGTCTGG + Intergenic
1104691214 12:130827822-130827844 CAGCTAAACCTGCCAGGTTCAGG - Intronic
1106106901 13:26741132-26741154 TAGCTAACACTTCCAGAGCCAGG - Intergenic
1106189161 13:27435848-27435870 TAGCTATTCCAGGCATAGTCTGG + Exonic
1107537150 13:41346640-41346662 TACCTAATCATCCCAGAGCCAGG - Intronic
1113533414 13:111045698-111045720 TTGCTTATCCTGGGAGAGTCTGG + Intergenic
1118192962 14:63596858-63596880 TAGAAAATCCTGCAAGTGTCCGG - Intergenic
1118607104 14:67512576-67512598 TAGCTAACCCTCCCAGAGCCTGG - Intronic
1118671943 14:68138040-68138062 TTGCTCATCCAGCCATAGTCTGG + Intronic
1118680561 14:68237213-68237235 TAACTCATTCTTCCAGAGTCAGG - Intronic
1124844192 15:33274883-33274905 TAGCAAAGCCAGCCAGAGCCGGG + Intergenic
1128561781 15:68673382-68673404 TAGCCAAGCATGCCTGAGTCCGG + Intronic
1133850839 16:9501797-9501819 TTGCCAGTCCTGCCTGAGTCAGG - Intergenic
1134686493 16:16162337-16162359 CAGCTAATACTGGCAGAGCCAGG - Intronic
1138121659 16:54405109-54405131 TAGGTATTCCTGCTAGAGTATGG + Intergenic
1139144984 16:64312488-64312510 TAGCTACTCCTTGCTGAGTCAGG - Intergenic
1139190926 16:64862040-64862062 CAGCTCAACTTGCCAGAGTCAGG + Intergenic
1141806166 16:86343110-86343132 CAGCTATTCCTGGCAGAGGCAGG + Intergenic
1150581323 17:66476480-66476502 GGTCTAATCCTGCCAGAGCCTGG + Intronic
1151545639 17:74791277-74791299 CAGCTACTCCAGCCAGGGTCAGG + Intronic
1158097829 18:53794648-53794670 TAGCTAATCCTGCTAGCTTTTGG - Intergenic
1158769389 18:60496181-60496203 TAGCTAATGCTACCACACTCAGG - Intergenic
1159744621 18:72216038-72216060 TAAAAAATCCTGCCAGAGACTGG + Intergenic
1159941074 18:74409167-74409189 TAGCTTATCCTTCAAGAGTGAGG - Intergenic
1159946544 18:74448118-74448140 CCGATAATCCTGCCAGAGGCAGG + Intronic
1160903846 19:1442880-1442902 TGGCTCATCCTGCTACAGTCTGG + Intergenic
1161581927 19:5085829-5085851 GAGAAAACCCTGCCAGAGTCAGG - Intronic
1168374786 19:55867628-55867650 TTGCCAATCCTGTCAGAGTCGGG - Intronic
927318856 2:21719562-21719584 TAGATAATCATCCCAGACTCTGG - Intergenic
928141166 2:28730557-28730579 AAGCTAATGCAGCCAGAGTATGG + Intergenic
935448193 2:103179287-103179309 TTTCTACTCCTGCAAGAGTCAGG - Intergenic
948976307 2:241465799-241465821 TACCCAATCCTGCGAGACTCTGG + Intronic
1172920217 20:38474595-38474617 AAGCTAATGCAGCCAGAGACAGG - Intronic
1181171687 22:21013622-21013644 TAGCTAATCCTGCCAGAGTCAGG + Intronic
1181177605 22:21046507-21046529 TAGCTAATCCTGCCAGAGTCAGG - Intronic
950449511 3:13057781-13057803 GAGCTCAGCCTGCCTGAGTCTGG + Intronic
951511939 3:23512033-23512055 TAGCTAATAAGGCCAGGGTCAGG + Intronic
952461139 3:33527638-33527660 TACCAAAACCTGGCAGAGTCTGG + Intronic
954391330 3:50269458-50269480 CCACTAATCCTACCAGAGTCTGG - Intronic
956187555 3:66576914-66576936 TTCCTTATCCTGCCAGAGGCCGG + Intergenic
960556465 3:119035317-119035339 TTCCTAATTCTGCCAGAGTCAGG - Intronic
965988756 3:174789907-174789929 CATCTAATGCTTCCAGAGTCAGG - Intronic
967461112 3:189746935-189746957 TAGCTAGTCCTGCTAGTGTTTGG - Intronic
970156308 4:13144981-13145003 TAGCTAATGCCCCCAGAGGCTGG + Intergenic
982061134 4:151605112-151605134 TTTCTAATCCTGCCAGATCCAGG - Intronic
985526271 5:403904-403926 TAGCTATTCCAGGCACAGTCTGG + Intronic
989566096 5:42902982-42903004 AAGCTAATTCTGCTAGAATCTGG - Intergenic
989567128 5:42911782-42911804 AAGCTAATTCTGCTAGAATCTGG + Intergenic
1000552578 5:162685226-162685248 GAGCTAATCCTGCCAACATCTGG + Intergenic
1011721652 6:90163116-90163138 TAGAGAATTCTGCCAAAGTCTGG - Intronic
1015870762 6:137774193-137774215 AAGCCAGTGCTGCCAGAGTCTGG + Intergenic
1016192766 6:141291088-141291110 TAGCTCATACTGGCAGAGCCAGG + Intergenic
1019544433 7:1566722-1566744 TCGCTGATCCTGCCTGAGTTGGG - Intergenic
1023564542 7:41510630-41510652 TAGTTAATCCTGCTTGAGTTTGG + Intergenic
1027825724 7:83113039-83113061 TAGCTACTGCTGCCAGATTTAGG - Intronic
1027849696 7:83434650-83434672 TAGCCAATTCTGCCAAAGTGTGG - Intronic
1031788951 7:126074641-126074663 TTGCTATTCCTGCCACAATCAGG - Intergenic
1042325233 8:67521338-67521360 TAGCCAATGCTGCCAGAGCTAGG - Intronic
1042435411 8:68758615-68758637 TAACTCTTCCTGCCAGAGTTTGG - Intronic
1042877175 8:73449856-73449878 GAGCTCCTCCTGCCAGAGGCAGG - Intronic
1043416073 8:80051408-80051430 TAGCTACTCCTGTTAGAGTGAGG - Intronic
1044020881 8:87104453-87104475 TACCAAGTCCTGCCAGAATCTGG - Intronic
1044845071 8:96372401-96372423 TAGCTACTCCCCCAAGAGTCGGG - Intergenic
1045205719 8:100037960-100037982 TAGTTATTAATGCCAGAGTCAGG + Intronic
1049951742 9:651418-651440 TAGCTATTCCTGCCACTGTTAGG - Intronic
1051510827 9:17875976-17875998 TAGGTAAACTTGCCAGATTCTGG + Intergenic
1055240850 9:74183864-74183886 TGGCTCATCCTGCCAAATTCTGG - Intergenic
1056031057 9:82553800-82553822 TTGCTGATACTGCCACAGTCTGG - Intergenic
1056306103 9:85292176-85292198 TAGCAGATCCTGTCAGTGTCTGG + Intergenic
1059113188 9:111576529-111576551 TAGCTAATACCCCCAGAGTTGGG - Intronic
1060016674 9:120092639-120092661 AAGCTTACCCTTCCAGAGTCTGG - Intergenic
1187333086 X:18358382-18358404 TAACTAAGCCTGGCAGAGACTGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1200655642 Y:5898927-5898949 TGGCTATTCCTGCAAGAGTAAGG - Intergenic
1200749131 Y:6928989-6929011 TAGCTGATACTGGCTGAGTCCGG + Intronic