ID: 1181173041

View in Genome Browser
Species Human (GRCh38)
Location 22:21020944-21020966
Sequence ATGTCGACACAGAGGGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181173041 Original CRISPR ATGTCGACACAGAGGGGGCT TGG Intronic
905481390 1:38264442-38264464 ATGAAGGCAAAGAGGGGGCTTGG - Intergenic
905731313 1:40301114-40301136 ATGTCCACCCAGAGGGGACCTGG + Exonic
916741294 1:167649328-167649350 ATTTCTACACAGAAGGCGCTTGG + Intronic
917560811 1:176153037-176153059 ATGTGGACACAGAGGGTTTTAGG + Intronic
1063257187 10:4340990-4341012 ATGAGGACCCAGAGGAGGCTGGG - Intergenic
1067080689 10:43210746-43210768 ATGTAGGCACAGACGGGGCCGGG + Intronic
1070722098 10:78764065-78764087 TTATCCACACAGATGGGGCTGGG - Intergenic
1072518480 10:96209887-96209909 AGGTCGAAACAGTGGGGCCTGGG - Exonic
1075342310 10:121657005-121657027 ATGAAGACACAGAGAGGGCCGGG - Intergenic
1075780780 10:125015897-125015919 GTGTGGACACACACGGGGCTGGG + Intronic
1076410596 10:130246271-130246293 ATGTCTCCACCGAGTGGGCTTGG + Intergenic
1079239006 11:18709364-18709386 GTGAGGACACAGAGAGGGCTGGG - Intronic
1085033149 11:73284701-73284723 ATGTCTACACAGAGAGGACTGGG - Intronic
1085244334 11:75087248-75087270 ATGTTGACACAGAGGAAGTTAGG + Intergenic
1089992543 11:122875213-122875235 ATGTCCACACAGGCGGGGCGTGG + Intergenic
1091706206 12:2695155-2695177 ATGTCAGCACAGAGAGGACTGGG + Intronic
1091711441 12:2743388-2743410 ATGTCAGCACAGAGAGGACTGGG + Intergenic
1095722284 12:45413679-45413701 GTGTCAACACAGAGAAGGCTTGG + Intronic
1097405586 12:59185488-59185510 ATGTCACCACTGAGGAGGCTGGG + Intergenic
1098498351 12:71163012-71163034 ATGTGGCCACAGAGGGGGCAGGG - Intronic
1104552116 12:129766767-129766789 AAGGCAACACAGAGGGGCCTGGG - Intronic
1107282817 13:38755945-38755967 ATGTAGACACAGCTGTGGCTTGG - Intronic
1113104325 13:106756825-106756847 TTGTCAACACAGATGGCGCTGGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119881293 14:78101782-78101804 ACGGGGACACAGGGGGGGCTTGG + Intergenic
1125511866 15:40296484-40296506 AGGATGACACAGAGGGGCCTGGG + Intronic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129618078 15:77115791-77115813 ATGTTGACACAAAGGGCGATGGG - Intronic
1133601654 16:7345619-7345641 ATGTAGACAGAGAGGGGACTCGG - Intronic
1136428840 16:30185700-30185722 ATGGAAACACAGAGGGGGTTGGG + Intronic
1138337810 16:56266951-56266973 ATGTGGACACGGTGGCGGCTGGG - Intronic
1138498772 16:57425541-57425563 ATGTGGACCGAGATGGGGCTGGG - Intergenic
1140062346 16:71581778-71581800 AGGTTGACACAGAGGAGACTGGG - Intergenic
1140406699 16:74716304-74716326 ATGAACACACATAGGGGGCTGGG + Intronic
1150211006 17:63441475-63441497 AGGGCCACACAGAGGGGGCCTGG + Intronic
1151523049 17:74644863-74644885 ATGAAGACACAGAGGGGTCAGGG - Intergenic
1152892744 17:82891753-82891775 TGGGGGACACAGAGGGGGCTGGG + Intronic
1152945710 17:83196384-83196406 TTGGAGACACAGAGGAGGCTGGG + Intergenic
1153020452 18:623985-624007 ATCTCGGCATGGAGGGGGCTGGG + Intronic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG + Intergenic
1162924143 19:13921319-13921341 ATTTAGCCACAGAGGAGGCTGGG + Intronic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
931302496 2:60994242-60994264 ATGTCCAAGAAGAGGGGGCTAGG - Intronic
932203601 2:69856752-69856774 AAGTGCACACTGAGGGGGCTAGG - Intronic
936075207 2:109397425-109397447 TTGTGTACACAGAGGTGGCTGGG - Intronic
942621407 2:177847839-177847861 ATGTCTACAGAGAGGGGTATGGG - Intronic
946157194 2:217814784-217814806 GGGTCATCACAGAGGGGGCTGGG - Intronic
1172813928 20:37671511-37671533 AGGTAGACCCAGAGGAGGCTGGG + Intergenic
1173061005 20:39661164-39661186 ATGTGGAGACAAAGGGGGCATGG - Intergenic
1174445058 20:50585396-50585418 ATGTGGACCCACAGGGGCCTGGG + Intergenic
1180051727 21:45334761-45334783 GTGTCCACACTGAAGGGGCTCGG - Intergenic
1181134954 22:20758744-20758766 ATGTAGACACAGGGCGGGGTGGG - Intronic
1181173041 22:21020944-21020966 ATGTCGACACAGAGGGGGCTTGG + Intronic
1184233630 22:43171559-43171581 ATGTGGACACAGAGGGGGATGGG - Intronic
1185079533 22:48701981-48702003 ATGTACACACAGAGGGGACCTGG + Intronic
949882923 3:8675724-8675746 ATGAGGTCACAAAGGGGGCTGGG + Intronic
950626673 3:14252591-14252613 AGGTAGACACAGAGAGAGCTAGG + Intergenic
952072635 3:29657101-29657123 ATTTCCACACACAGGAGGCTGGG + Intronic
952874427 3:37931448-37931470 GAGAAGACACAGAGGGGGCTGGG - Intronic
954135115 3:48578882-48578904 ATGCTGGGACAGAGGGGGCTCGG - Intronic
955339238 3:58112179-58112201 CTGTCTACACCAAGGGGGCTGGG + Exonic
956681521 3:71785562-71785584 CTGTGGACACATAGGGGGCGGGG + Intergenic
958021224 3:87998839-87998861 ATTGTGAAACAGAGGGGGCTGGG - Intergenic
960396971 3:117149681-117149703 AGGCAGACACAGAGGGGACTTGG + Intergenic
962328024 3:134451898-134451920 ATGTGCTCACAGAGGGGGCTGGG + Intergenic
968266436 3:197366958-197366980 ACCTCGCCACAGAGGGGGCCTGG - Intergenic
981033467 4:140149371-140149393 AGGCTGCCACAGAGGGGGCTGGG - Intronic
986151607 5:5134929-5134951 TTGTGGAAACACAGGGGGCTGGG + Intergenic
988323967 5:29737970-29737992 GTGTTGGTACAGAGGGGGCTGGG - Intergenic
1001168207 5:169391138-169391160 ATGTCTACACAGGGGCAGCTTGG + Intergenic
1001260860 5:170227389-170227411 ATGGAAACACAGAAGGGGCTGGG + Intergenic
1001926376 5:175640098-175640120 ACCTGGACACAGAGAGGGCTAGG - Intergenic
1002803799 6:552217-552239 ATGTCGGCAGTGAGGGGGCCTGG - Intronic
1003502657 6:6715114-6715136 ATGATGACACAGACAGGGCTAGG + Intergenic
1006948334 6:37800560-37800582 ATGTGGACACTGAGGGGGCTGGG - Intergenic
1015580954 6:134724556-134724578 ATGTAGACACAGAAAGGTCTTGG - Intergenic
1021577307 7:22116178-22116200 ATGGCTAGACAGGGGGGGCTTGG + Intergenic
1023558948 7:41452428-41452450 ATGTGGACACACTGGGGCCTCGG - Intergenic
1023677197 7:42643013-42643035 ATGCCTAGACAGATGGGGCTGGG + Intergenic
1026850206 7:73719197-73719219 CTGTCTACACCGAGGGGGCACGG + Intronic
1028505953 7:91570351-91570373 TTGTCAACACAGAGAGGGCAAGG - Intergenic
1035058959 7:156055201-156055223 ATGTTGACACAGGTGGGGGTGGG - Intergenic
1047680867 8:127252784-127252806 ATGTCCTGACAGAGGTGGCTTGG + Intergenic
1051508142 9:17847471-17847493 GTGTGGATCCAGAGGGGGCTGGG - Intergenic
1053200683 9:36149647-36149669 ATCTCTACAGAGAGGGGGTTGGG + Intronic
1056558235 9:87707200-87707222 ATGTCCAAACTGAGGGAGCTGGG + Exonic
1061878628 9:133557354-133557376 ATGTGGACAGAGTGGGGCCTCGG + Intronic
1189424085 X:40882519-40882541 GTGTCCACACAGAGTGGGCTGGG + Intergenic
1192158386 X:68763977-68763999 ATGACCACACAGAGGAGGGTGGG + Intergenic
1194597535 X:95877307-95877329 ATGTCATCACATTGGGGGCTAGG + Intergenic
1196054287 X:111338525-111338547 AGGTTGACACAGAGTTGGCTTGG + Intronic
1200275560 X:154729069-154729091 ATGGCGACACTGAGGGAACTGGG + Intronic