ID: 1181174978

View in Genome Browser
Species Human (GRCh38)
Location 22:21030190-21030212
Sequence CGGGCTCCTCACGGCCTTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 149}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181174978_1181174989 14 Left 1181174978 22:21030190-21030212 CCAGGAAGGCCGTGAGGAGCCCG 0: 1
1: 0
2: 4
3: 19
4: 149
Right 1181174989 22:21030227-21030249 CGCCACAGGCACCTGTGTCCGGG 0: 1
1: 0
2: 3
3: 21
4: 193
1181174978_1181174984 0 Left 1181174978 22:21030190-21030212 CCAGGAAGGCCGTGAGGAGCCCG 0: 1
1: 0
2: 4
3: 19
4: 149
Right 1181174984 22:21030213-21030235 AACGCCAGGGTGCCCGCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 83
1181174978_1181174994 25 Left 1181174978 22:21030190-21030212 CCAGGAAGGCCGTGAGGAGCCCG 0: 1
1: 0
2: 4
3: 19
4: 149
Right 1181174994 22:21030238-21030260 CCTGTGTCCGGGGGTGCACATGG 0: 1
1: 0
2: 1
3: 10
4: 167
1181174978_1181174995 26 Left 1181174978 22:21030190-21030212 CCAGGAAGGCCGTGAGGAGCCCG 0: 1
1: 0
2: 4
3: 19
4: 149
Right 1181174995 22:21030239-21030261 CTGTGTCCGGGGGTGCACATGGG 0: 1
1: 0
2: 0
3: 10
4: 145
1181174978_1181174990 15 Left 1181174978 22:21030190-21030212 CCAGGAAGGCCGTGAGGAGCCCG 0: 1
1: 0
2: 4
3: 19
4: 149
Right 1181174990 22:21030228-21030250 GCCACAGGCACCTGTGTCCGGGG 0: 1
1: 0
2: 2
3: 13
4: 177
1181174978_1181174992 16 Left 1181174978 22:21030190-21030212 CCAGGAAGGCCGTGAGGAGCCCG 0: 1
1: 0
2: 4
3: 19
4: 149
Right 1181174992 22:21030229-21030251 CCACAGGCACCTGTGTCCGGGGG 0: 1
1: 0
2: 2
3: 10
4: 162
1181174978_1181174988 13 Left 1181174978 22:21030190-21030212 CCAGGAAGGCCGTGAGGAGCCCG 0: 1
1: 0
2: 4
3: 19
4: 149
Right 1181174988 22:21030226-21030248 CCGCCACAGGCACCTGTGTCCGG 0: 1
1: 0
2: 0
3: 18
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181174978 Original CRISPR CGGGCTCCTCACGGCCTTCC TGG (reversed) Exonic
900129032 1:1079919-1079941 CGGTCTCCTCACGCCCTCTCAGG + Intergenic
900329223 1:2125820-2125842 CGGCCTCCTCACGTCCATGCGGG + Intronic
900562358 1:3313617-3313639 CGGGGTCCGCACGGCCTCGCAGG - Intronic
901307263 1:8241645-8241667 CGGGCTCCTCCCTTCCTTCAAGG - Intergenic
902368991 1:15993799-15993821 CGGGGTCCCCATGGGCTTCCTGG - Intergenic
902456376 1:16536507-16536529 GAGGCTCCTCTCGGCCCTCCTGG + Intergenic
902495787 1:16871404-16871426 GAGGCTCCTCTCGGCCCTCCTGG - Intronic
903072280 1:20732271-20732293 CGAGCCCCTCCCGCCCTTCCAGG - Exonic
903435119 1:23343873-23343895 CGGGCGCCTCAGGCCCTTCGCGG + Intronic
903656098 1:24949725-24949747 TGGGCTCCTGACGGCCTCCCTGG - Intronic
903760441 1:25694347-25694369 GGGGCTCCTCATGGTCATCCTGG - Intronic
906128829 1:43443671-43443693 AAGGCTCCTCACGGGCTCCCGGG - Exonic
906214333 1:44030383-44030405 CCGGCCCCTCCCGGCCCTCCGGG + Intronic
906460266 1:46031115-46031137 TGGCCTCCTCAGGGCCCTCCGGG - Exonic
907232749 1:53015333-53015355 AGGTCTCCTCATGGCCTTCCAGG + Intronic
908356799 1:63330203-63330225 CTGGGTCCTCTCGGCCTCCCAGG - Intergenic
920177610 1:204112911-204112933 GGGGCTCCTCATGGACATCCTGG - Exonic
920374362 1:205499440-205499462 CTGGCTCCTCAAGGGCTACCTGG + Intergenic
921826261 1:219675188-219675210 TTGGCTCCTGACTGCCTTCCTGG + Intergenic
923814273 1:237358349-237358371 CGGGTTCCTCACGCCCTACTTGG + Intronic
924706568 1:246507263-246507285 CGGGCGTCTCACGGGCTGCCGGG + Intronic
1063965793 10:11344767-11344789 AGGGTTCCTCGCGGCCTTGCAGG - Intergenic
1072798833 10:98377725-98377747 CTGCCTCCTCACGGCCAGCCAGG + Intergenic
1075522852 10:123154516-123154538 CGGGCTCTCCAGGGACTTCCCGG + Intronic
1076474067 10:130740268-130740290 TGGGCTCCACAGGGCCTTCCGGG - Intergenic
1076706293 10:132303543-132303565 CAGGTTCCTCTCGCCCTTCCTGG - Intronic
1077104240 11:835055-835077 CCCGCTCCCCACGGCATTCCCGG - Intronic
1077423960 11:2465847-2465869 CAGGCTCCAAATGGCCTTCCAGG - Intronic
1078670258 11:13358018-13358040 CGGGCTCCTCACAGACCTCAGGG + Intronic
1078821983 11:14891912-14891934 CGGGCTGGCCAGGGCCTTCCTGG - Intronic
1078928193 11:15892776-15892798 AGGCATCTTCACGGCCTTCCTGG - Intergenic
1079168898 11:18073247-18073269 AGGGCTTCTCACTGCCTTCAAGG + Intronic
1081502569 11:43680911-43680933 CTCGCTCTTCACGGCCCTCCGGG + Exonic
1081574689 11:44311560-44311582 CGCTGTCCGCACGGCCTTCCAGG - Intergenic
1081690911 11:45077879-45077901 AGGGCTCATAACGGCCTTCTTGG - Intergenic
1084090580 11:66876996-66877018 CCGCCTCCTGAAGGCCTTCCTGG - Intronic
1086179433 11:83932996-83933018 TGGGCTCCTCACAGACTTCTCGG + Intronic
1090334598 11:125954178-125954200 CGGGAACCTGACGGGCTTCCTGG + Intergenic
1096459429 12:51814209-51814231 CGGCCTCCTCACCGGCTTCGTGG - Intergenic
1097020125 12:56014831-56014853 CAGGCTACTCAAGGCCTTCATGG - Intronic
1102573946 12:113844254-113844276 AGGGATGCTCACGGCCTTCCTGG - Intronic
1104416987 12:128603700-128603722 CAGCCTCCTCACTACCTTCCAGG + Intronic
1104953660 12:132453633-132453655 CGGGCTCCTGATCACCTTCCTGG + Intergenic
1107984545 13:45764233-45764255 CCTGCTCTTCACGGCCTTCCTGG + Intergenic
1108362328 13:49678619-49678641 CGGGCTGCGCACGGCGCTCCCGG - Intronic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1113746153 13:112746350-112746372 CCGGCTCCCCACGTCCTCCCCGG + Intronic
1113763661 13:112867511-112867533 GGGGCTTCTCTCAGCCTTCCTGG + Intronic
1114305571 14:21419991-21420013 TGGGCTCCTCCAGGCCTTTCTGG + Intronic
1117654875 14:57944822-57944844 TTGTCTCCTCATGGCCTTCCTGG - Intronic
1119418848 14:74494047-74494069 CAGGCTCCTCACGGCCTCCCTGG + Exonic
1119448084 14:74683413-74683435 TGGGCTCCTGAAGGACTTCCTGG + Exonic
1119569992 14:75661527-75661549 CGGGGTCGTCCCGTCCTTCCCGG + Intronic
1121839535 14:97121186-97121208 CTGGCTCCTCATGGCCCTTCAGG + Intergenic
1122788685 14:104175445-104175467 CGGGGTGCCCACGGCCTTCCTGG - Exonic
1122860871 14:104581867-104581889 CGGCAGCCTCACAGCCTTCCAGG - Intronic
1122887310 14:104715829-104715851 CGGTCTCCTCACAGACTTCCTGG - Intronic
1123006958 14:105328368-105328390 CTGCCTCCTCTGGGCCTTCCTGG + Intronic
1128726454 15:69991712-69991734 CTGGCTCCCCAGGGCCTTTCAGG + Intergenic
1130517166 15:84634142-84634164 CCGGCGCCTCGCTGCCTTCCTGG - Intergenic
1131548783 15:93338587-93338609 CAGGCCCCTCACAGCCTGCCTGG - Intergenic
1132836041 16:1954010-1954032 CGTGCACCTCACGGCCTTCCTGG - Exonic
1134338339 16:13322333-13322355 CTGGCTACTCAGGGCCCTCCTGG - Intergenic
1136221934 16:28834705-28834727 CTGGATCCTCACTGCCCTCCTGG - Intronic
1136549942 16:30977659-30977681 CTGGGTCCTCACTGGCTTCCTGG + Intronic
1137288795 16:47037787-47037809 CGCGGTCCTCGCGGCCTCCCCGG - Intergenic
1138379533 16:56590432-56590454 CCGCCTCCCCACGGCTTTCCTGG + Intronic
1138651873 16:58465263-58465285 GGGGCTGATCACTGCCTTCCAGG + Intronic
1141227199 16:82129167-82129189 CGGGCTCACCTCAGCCTTCCAGG - Intergenic
1141987510 16:87589444-87589466 TGGGCCCCTCACAGACTTCCTGG + Intergenic
1142132435 16:88437204-88437226 CGGGCTCCCGGCGGCCTTGCCGG - Exonic
1142335961 16:89489980-89490002 TGGGCCCCTCACGGCCACCCCGG + Intronic
1142472928 17:173131-173153 CTGGCTCCTCACGGCCTGCTCGG - Intronic
1146280437 17:31541055-31541077 CGGACTTCTCACAGCCTTGCTGG + Intergenic
1147989963 17:44326622-44326644 AGGGCTCCACACTGCCTCCCCGG + Intergenic
1148106154 17:45120114-45120136 CCGGCTCCCCACTCCCTTCCTGG + Intronic
1149368741 17:55971619-55971641 CTGTCTCCTTACGGCCTTCTAGG + Intergenic
1149430663 17:56593905-56593927 CCGGCTCCTCGCTGCCTTCCCGG - Exonic
1151823871 17:76512779-76512801 CGGGCTCCCCACGGCCTCCCCGG - Intergenic
1152561944 17:81083034-81083056 CCGGGTCCTCTCGCCCTTCCAGG - Intronic
1152593164 17:81223362-81223384 CGTGCTCCTCGCGCCCTCCCTGG - Intergenic
1152690059 17:81713865-81713887 CTGGCTCCTCCCGCCCTCCCAGG - Intronic
1156473996 18:37394396-37394418 AGGGCAGCTCACGGCCTGCCTGG - Intronic
1157867129 18:51197025-51197047 CGGGCTCCGCCCGGCCGGCCCGG - Exonic
1161032560 19:2064938-2064960 CGTTCTCCTGCCGGCCTTCCCGG + Intergenic
1161262361 19:3345050-3345072 ATGGCTCCTCACTGCCCTCCAGG - Intergenic
1162356164 19:10186316-10186338 CCAGCTCCTCACTGCCTGCCTGG - Intronic
1163692777 19:18746271-18746293 CTCCCTGCTCACGGCCTTCCTGG - Intronic
1165453002 19:35896099-35896121 CCCGCTCCACACGGCCATCCTGG - Exonic
1165797067 19:38525673-38525695 CGGGGTCCTCAGGGCATCCCAGG - Intronic
1166888068 19:45973492-45973514 CGGCCTCTTCACGGCCTCCGCGG - Exonic
1167035861 19:46994629-46994651 CCGGCTCCTCGAGGCCTTCCTGG - Intronic
1167246056 19:48373810-48373832 CTGGCTCCCCAGGGCCTCCCGGG + Intronic
1202707270 1_KI270713v1_random:32863-32885 GAGGCTCCTCTCGGCCCTCCTGG + Intergenic
925905682 2:8538626-8538648 CGGGCTCCCCACGATCTGCCTGG + Intergenic
925933885 2:8734343-8734365 CAGGCTCCTCAAAGCCTTCGAGG - Intronic
926226723 2:10972045-10972067 CGAGCTCCTCCCGGGTTTCCTGG - Intergenic
927085365 2:19669897-19669919 AGGGGTCCTCAGAGCCTTCCTGG + Intergenic
931900498 2:66782967-66782989 CTGGCTCAGCAAGGCCTTCCAGG + Intergenic
932599980 2:73116966-73116988 GGGTGTCCTCACTGCCTTCCTGG + Intronic
937340650 2:121088607-121088629 CAGGGTCCTCAATGCCTTCCAGG + Intergenic
938067226 2:128287698-128287720 CGGGCTGCTCACAGCCATGCTGG - Intronic
942308683 2:174633794-174633816 CGGCCTCTTCACGGCCTGCTGGG + Intronic
1171336885 20:24393206-24393228 TGGGCTCCTGATGGCCATCCAGG - Intergenic
1173401257 20:42728038-42728060 CTGGCTCCAGACGACCTTCCAGG + Intronic
1175904069 20:62371282-62371304 GGGGCTCTTCAAAGCCTTCCAGG + Intergenic
1177790644 21:25718718-25718740 CTGGCCCCTCATCGCCTTCCTGG + Intronic
1178486499 21:33023032-33023054 CGGGCTCCTCCCGGGCCGCCCGG + Intergenic
1178725892 21:35051442-35051464 CTGGCCCTGCACGGCCTTCCTGG + Intronic
1180223724 21:46376478-46376500 CGGGCTCCTCAGGCCCAGCCAGG - Intronic
1181174978 22:21030190-21030212 CGGGCTCCTCACGGCCTTCCTGG - Exonic
1181580465 22:23825160-23825182 CCCGCTCCTCGCGGCCTCCCTGG + Intronic
1181964191 22:26645246-26645268 CAGGCTCCTCGCGGCCTCCCTGG - Intergenic
1183432695 22:37775150-37775172 CTGGGTTCTCACAGCCTTCCAGG - Exonic
1184182660 22:42841202-42841224 CTGGCTCCTCTCGTCCTTCCTGG + Intronic
1184889737 22:47372335-47372357 CGTCCTCCTCACGGCTTCCCAGG - Intergenic
1185369707 22:50455422-50455444 CGGGCTCCTCGCTGACCTCCTGG - Intronic
949364352 3:3264539-3264561 TGGGCTGCTCAGTGCCTTCCAGG - Intergenic
949896067 3:8768340-8768362 CGGTCTCCTCACGGCCCTCCCGG - Intronic
950675609 3:14552524-14552546 CTGGCTCCTCACCTCCTGCCTGG + Intergenic
956567775 3:70658789-70658811 CATCCTCCTCACGGCTTTCCTGG + Intergenic
957790054 3:84929243-84929265 CTGCCTCCTCACGGCATTCCCGG + Intergenic
967391384 3:188959123-188959145 CAGGCACCTCAAGGCCTCCCAGG - Intronic
968576063 4:1366725-1366747 CGGGCACCTGAGGGCCTGCCTGG - Intronic
968957048 4:3724905-3724927 CTGGCACCTGCCGGCCTTCCTGG + Intergenic
969114042 4:4860309-4860331 CGGGGTCCTCTCGGGCTTCTCGG - Exonic
981568925 4:146131416-146131438 CGGGCCCAGCAGGGCCTTCCAGG - Intergenic
986094859 5:4544512-4544534 CGGGCTCTACCCGGCATTCCAGG - Intergenic
986320980 5:6632832-6632854 GGGGCTCCTCCTGGGCTTCCCGG - Intronic
989560178 5:42841377-42841399 TGGCTTCCTCACAGCCTTCCAGG - Intronic
993595686 5:89852131-89852153 CGGGCACATCAAGGCCTGCCAGG - Intergenic
1001759274 5:174194139-174194161 AGGGCTCCTCATGTCCCTCCTGG + Intronic
1002359947 5:178662436-178662458 CTGGCCCCTCACTGCCCTCCAGG - Intergenic
1002634597 5:180600846-180600868 CGGGCTCCTCTGGAACTTCCTGG - Intergenic
1002877144 6:1220745-1220767 CGGGCCCCTCATGCCATTCCTGG - Intergenic
1003567051 6:7230667-7230689 CAAGCCCCTCACTGCCTTCCTGG + Exonic
1005652866 6:27900622-27900644 CCCACTCCTCATGGCCTTCCTGG + Intergenic
1017914150 6:158818928-158818950 TCGGCTTCTCACGGGCTTCCTGG - Intronic
1018592381 6:165441732-165441754 CGGGCTCATCACTGTCTCCCCGG + Intronic
1019162101 6:170075769-170075791 CGGGCTCCTCCGGGCTATCCTGG - Intergenic
1019295986 7:275627-275649 GGGGGTCCTCAGGGGCTTCCAGG - Intergenic
1024194585 7:47046580-47046602 CGGACACCTCAAGTCCTTCCAGG + Intergenic
1026669613 7:72377866-72377888 GGGCCTCCTCAGGTCCTTCCTGG + Intronic
1026881253 7:73908155-73908177 CTGGCTCCCCACTGCCCTCCAGG + Intergenic
1029750377 7:102539625-102539647 CGTCCTCCTCACGGTCCTCCTGG - Intronic
1029768329 7:102638733-102638755 CGTCCTCCTCACGGTCCTCCTGG - Exonic
1029794170 7:102876160-102876182 TGGGCTCCTCTGGGTCTTCCTGG - Intronic
1034417997 7:150975190-150975212 CGGGCTGCTGGCGGCCTGCCCGG - Intronic
1034468951 7:151245646-151245668 CGGGCTCCAGACGGCATCCCGGG + Exonic
1035486673 7:159231443-159231465 CGGTCTCCTCAGGGCCTCCTCGG + Intergenic
1039507088 8:38059966-38059988 GGGGCCCCTCAGGGCCTTCCTGG + Exonic
1041107606 8:54458128-54458150 CGGGCTGCTCATGGCGCTCCAGG - Exonic
1041108871 8:54467197-54467219 CGGCCTGCTCACGGCGCTCCAGG - Intergenic
1041511475 8:58659238-58659260 CGGACCCCGCGCGGCCTTCCGGG + Exonic
1044666554 8:94639531-94639553 CGGGCTCCTCTCCCCCCTCCCGG + Intergenic
1045300563 8:100907210-100907232 CTGTCTCCTGACAGCCTTCCAGG - Intergenic
1048012488 8:130469458-130469480 CAGGCTGCTAACTGCCTTCCAGG + Intergenic
1049206098 8:141364267-141364289 CGTGGCCCTCATGGCCTTCCAGG + Intronic
1050358496 9:4805072-4805094 CGGGCTCCTGAGGGCCTTCAGGG - Intronic
1052896167 9:33750350-33750372 CGGGCTCCTCGCCGCCTCCCAGG + Intergenic
1056579975 9:87883484-87883506 CTGGCTCATCACCCCCTTCCTGG + Intronic
1060161666 9:121370241-121370263 CTGGCTCCTCAGGGCATTCCCGG - Intronic
1060174161 9:121485300-121485322 CCAGCTCCTCACGGTTTTCCTGG - Intergenic
1060560655 9:124540032-124540054 CAGGCTCCACACTGTCTTCCAGG - Exonic
1061570331 9:131474081-131474103 CAGACTCTTCACGGCCTCCCAGG + Intronic
1061624779 9:131835302-131835324 CGGGCGCCTCCCGGGCTGCCGGG + Intergenic
1062209009 9:135353216-135353238 CAGACTGCTCACGGCCTGCCCGG + Intergenic
1185643655 X:1601604-1601626 CGGCCTCCCCACGGCCTGTCCGG + Exonic
1186230137 X:7444890-7444912 CAGGCTTCTCTCGGCCTTCCTGG - Intergenic
1195221249 X:102746543-102746565 CCGGCTCCCCCCGGCCTTCCCGG - Intronic
1199984904 X:152943494-152943516 CGAGCTCCTCATGAACTTCCTGG - Intronic
1200128310 X:153828582-153828604 GGGGCTCCCCACAGCCCTCCGGG - Intronic
1201461653 Y:14232305-14232327 TGGTATCCTCACGGCCTTCTTGG + Intergenic