ID: 1181174997

View in Genome Browser
Species Human (GRCh38)
Location 22:21030250-21030272
Sequence GGTGCACATGGGCAAACACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 163}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181174983_1181174997 17 Left 1181174983 22:21030210-21030232 CCGAACGCCAGGGTGCCCGCCAC 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1181174997 22:21030250-21030272 GGTGCACATGGGCAAACACCTGG 0: 1
1: 0
2: 0
3: 13
4: 163
1181174986_1181174997 2 Left 1181174986 22:21030225-21030247 CCCGCCACAGGCACCTGTGTCCG 0: 1
1: 0
2: 1
3: 10
4: 230
Right 1181174997 22:21030250-21030272 GGTGCACATGGGCAAACACCTGG 0: 1
1: 0
2: 0
3: 13
4: 163
1181174985_1181174997 10 Left 1181174985 22:21030217-21030239 CCAGGGTGCCCGCCACAGGCACC 0: 1
1: 0
2: 5
3: 20
4: 255
Right 1181174997 22:21030250-21030272 GGTGCACATGGGCAAACACCTGG 0: 1
1: 0
2: 0
3: 13
4: 163
1181174982_1181174997 18 Left 1181174982 22:21030209-21030231 CCCGAACGCCAGGGTGCCCGCCA 0: 1
1: 0
2: 1
3: 4
4: 84
Right 1181174997 22:21030250-21030272 GGTGCACATGGGCAAACACCTGG 0: 1
1: 0
2: 0
3: 13
4: 163
1181174991_1181174997 -2 Left 1181174991 22:21030229-21030251 CCACAGGCACCTGTGTCCGGGGG 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1181174997 22:21030250-21030272 GGTGCACATGGGCAAACACCTGG 0: 1
1: 0
2: 0
3: 13
4: 163
1181174987_1181174997 1 Left 1181174987 22:21030226-21030248 CCGCCACAGGCACCTGTGTCCGG 0: 1
1: 0
2: 0
3: 16
4: 227
Right 1181174997 22:21030250-21030272 GGTGCACATGGGCAAACACCTGG 0: 1
1: 0
2: 0
3: 13
4: 163
1181174979_1181174997 28 Left 1181174979 22:21030199-21030221 CCGTGAGGAGCCCGAACGCCAGG 0: 1
1: 0
2: 1
3: 11
4: 96
Right 1181174997 22:21030250-21030272 GGTGCACATGGGCAAACACCTGG 0: 1
1: 0
2: 0
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181174997 Original CRISPR GGTGCACATGGGCAAACACC TGG Exonic
900993982 1:6110429-6110451 GGTCCACAAGGGCAACTACCTGG - Exonic
901135955 1:6995748-6995770 GGGGCACATGGGAGAGCACCAGG + Intronic
905471433 1:38195091-38195113 ACTGCACATGAACAAACACCAGG - Intergenic
906803533 1:48758327-48758349 GGTGAGCATGGGCAAATACCTGG - Intronic
910913341 1:92261246-92261268 CTTGCACAAGGGCAAACATCTGG - Intronic
911291431 1:96060806-96060828 GGTTCCCACTGGCAAACACCTGG - Intergenic
912331075 1:108820548-108820570 GGTGAACATGAGCCCACACCAGG - Exonic
912982879 1:114393597-114393619 GGACCACATAGGCAAACACAAGG + Exonic
915030393 1:152875264-152875286 TGTACACATGTGCACACACCTGG + Intergenic
921603122 1:217128066-217128088 TGTGCTAATGGGCAAACCCCTGG - Intronic
922355881 1:224774600-224774622 GGGCCACATGGGGAAGCACCAGG - Intergenic
923078269 1:230629505-230629527 GGGCCACATGGGGAAGCACCAGG - Intergenic
924781585 1:247153910-247153932 GGTGCAGATGAGCAAAGACAAGG - Intronic
1063429995 10:5979858-5979880 GTTGCACATGGACATACACATGG - Intergenic
1064495419 10:15904979-15905001 TGTGCACATGCACACACACCAGG + Intergenic
1071522669 10:86340829-86340851 GGTGGCCCTGGACAAACACCTGG + Intronic
1073668495 10:105560781-105560803 GGAACACATGGGGAAGCACCAGG - Intergenic
1075238013 10:120749254-120749276 AGTGCACTTGGGTAAACAGCTGG + Intergenic
1075764350 10:124880626-124880648 GGGCCACAAGGGCAAGCACCAGG + Intergenic
1077203526 11:1327154-1327176 GGTGCACAGAGGCAATCACAGGG - Intergenic
1077989486 11:7391017-7391039 GGTGCACATGGACATAGACATGG - Intronic
1081743624 11:45457958-45457980 GGGCCACATGGGGAAACACCAGG + Intergenic
1083374220 11:62206533-62206555 GGTCCACAGGAGCAAGCACCTGG + Intergenic
1083379993 11:62259137-62259159 GGTGCACATGGACACAAACATGG + Intergenic
1086886478 11:92211758-92211780 GTTGCACATGCACGAACACCAGG + Intergenic
1087065248 11:94021785-94021807 GGTGGAAATTGTCAAACACCTGG - Intronic
1088448760 11:109960567-109960589 GGGCCACATGGGGAAGCACCAGG + Intergenic
1091240405 11:134048160-134048182 GTTGCACATGGGCAAACTGTAGG - Intergenic
1094474299 12:30829457-30829479 GATGCACAAGGTCAAACAGCTGG - Intergenic
1095307346 12:40653631-40653653 GGCACACATGGGCAATGACCTGG - Intergenic
1096638246 12:52974894-52974916 GGTGTGGCTGGGCAAACACCAGG + Intergenic
1096966128 12:55629535-55629557 GGGCCACATGAGAAAACACCAGG + Intergenic
1097266886 12:57751269-57751291 GGTCTACATGCTCAAACACCAGG + Exonic
1099773331 12:87092853-87092875 GGTACCCAAGAGCAAACACCAGG - Intergenic
1100221443 12:92508445-92508467 GGAGCATATGGGGAAGCACCAGG - Intergenic
1101442852 12:104716347-104716369 GGTGCTCATGGTCACACAGCTGG - Intronic
1101741423 12:107503057-107503079 GGGTCACATGGGGAAGCACCAGG + Intronic
1101938455 12:109080101-109080123 CGTGCACAGGGGGAAACTCCAGG - Intronic
1103875026 12:124120334-124120356 GGCACTAATGGGCAAACACCTGG - Intronic
1107079046 13:36354637-36354659 GGTGCACAGAGGCAAAGTCCAGG - Intronic
1110637163 13:77779549-77779571 GATGCAAATGGGTACACACCTGG + Intergenic
1111901673 13:94207173-94207195 GGGCCACATGGGTAAGCACCAGG - Intronic
1113990233 14:16022931-16022953 GCTGCCCAGGGGCAAACAGCCGG - Intergenic
1121319810 14:92985611-92985633 GGTACACATTTGCAAACACGGGG + Intronic
1126998485 15:54474697-54474719 AGTGCAAATGGACCAACACCAGG - Intronic
1128736375 15:70056184-70056206 GGTGCACCAGGGCAAACCCTTGG + Intronic
1128796888 15:70472671-70472693 GGGCCACGTGGGGAAACACCAGG - Intergenic
1129045747 15:72732754-72732776 GGGCCACATGGGGAAGCACCAGG + Intronic
1129904712 15:79178340-79178362 GGTGCAAATGGGCAGAGATCAGG + Intergenic
1133186115 16:4099920-4099942 GGTGCACATGTGCAGTCACAGGG + Intronic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1133781568 16:8942868-8942890 GGTGCATATGGCCAAATAACTGG - Intronic
1133948420 16:10369113-10369135 GTTGCACATGTTCAAATACCAGG + Intronic
1134183559 16:12066048-12066070 GGGGCCCGTGGGCAATCACCTGG + Intronic
1141374467 16:83517615-83517637 GGAACACGTGGGCAATCACCAGG + Intronic
1142174388 16:88638558-88638580 GGTGCACCTGGCCATGCACCTGG - Intergenic
1147896041 17:43752033-43752055 TGGGCACATGGGCAATAACCAGG - Intergenic
1149432884 17:56608457-56608479 TGTGCCCATGGACAAACAGCTGG - Intergenic
1150462905 17:65367540-65367562 GGTGCACATGGACATACACTGGG - Intergenic
1152150808 17:78599843-78599865 AGTGCACATGGGCACCCAGCAGG + Intergenic
1152234423 17:79131096-79131118 GGCGCACATGTGCACACACGGGG - Intronic
1153483777 18:5574804-5574826 GGTGCACAGGGGCAAAGTCTTGG - Intronic
1154027213 18:10719393-10719415 GGTGCACATGGGCATACGGAGGG - Intronic
1155315670 18:24568068-24568090 GGGGCACATGGGGAAGGACCAGG + Intergenic
1156921406 18:42526894-42526916 GGGCCACATGGGCAAGCACCAGG - Intergenic
1157486916 18:48094261-48094283 GTTGCACATGAGCTAAAACCCGG - Intronic
1161396669 19:4048207-4048229 GGTGCACATGCGGAAGCACACGG - Exonic
1161945730 19:7435404-7435426 GGGCCACATGGGGAAGCACCAGG + Intronic
1163840193 19:19603128-19603150 GGGCCACATGGGGAAGCACCTGG - Intronic
1164206198 19:23060786-23060808 GTCTCTCATGGGCAAACACCAGG + Intergenic
1165034510 19:33023036-33023058 GGTGCAGATGGGAAAACTCAGGG - Intronic
1166613123 19:44217735-44217757 TGTACACATGGGCTAACAGCAGG + Intronic
1167623468 19:50571244-50571266 CGTGCACAGGGGCAAGCACCTGG + Intergenic
1168502863 19:56908168-56908190 GGGGAACATGGGGAAGCACCAGG - Intergenic
925106753 2:1298563-1298585 GGTGCCCCTGGGTGAACACCAGG + Intronic
929040335 2:37738390-37738412 GGTCCACACGGGGAAGCACCAGG + Intronic
932442230 2:71744775-71744797 AGTGCACATGGAAACACACCTGG - Intergenic
932794553 2:74683016-74683038 GGGCCACATGGGGAAGCACCAGG - Intronic
933839587 2:86275709-86275731 GGGCCACATGGGGAAGCACCAGG - Intronic
936484588 2:112915392-112915414 GGTGCACACTGGGAATCACCTGG - Intronic
936885650 2:117308129-117308151 GGTGCCCATGGGAAAAAAACTGG + Intergenic
937287602 2:120763012-120763034 GGACCACATGGGCAAAGCCCTGG + Intronic
938390055 2:130897899-130897921 GCTGCAGATTGGCAAATACCGGG + Intronic
939090303 2:137772605-137772627 GGTCCACATGAGGAAGCACCAGG + Intergenic
942252545 2:174059781-174059803 GGGCCACATGGGGAAGCACCAGG - Intergenic
945780402 2:214164378-214164400 GATACACATGAGCAGACACCTGG + Intronic
947186110 2:227456971-227456993 GGGGCACAGAGGCAAACACAAGG + Intergenic
948055093 2:235005141-235005163 GTGACACCTGGGCAAACACCTGG - Intronic
948613334 2:239183518-239183540 AGGGCACGTGGGCACACACCTGG - Intronic
1168840750 20:908551-908573 GTTGCACATGGGAAATCACTAGG + Intronic
1169096010 20:2899383-2899405 GGACCACATGGGGAAGCACCAGG + Intronic
1169580062 20:7011577-7011599 AGAGCACATGGACAAAGACCTGG + Intergenic
1172012350 20:31852942-31852964 GGTGCACAAGGGCAAGCATTTGG - Intronic
1172641452 20:36442753-36442775 GCTGCTCATGGCCAAACAACTGG - Exonic
1173871451 20:46344567-46344589 GGTGCACATGGGGAAAGAGGAGG - Intergenic
1174519632 20:51119540-51119562 TGTGCACATGTGACAACACCAGG - Intergenic
1176877051 21:14141691-14141713 TGTGTACATGGGCAAATGCCAGG - Intronic
1180317039 22:11284595-11284617 GCTGCCCAGGGGCAAACAGCTGG + Intergenic
1181057499 22:20267151-20267173 TGTGCACATGCACAAACACTGGG - Intronic
1181174997 22:21030250-21030272 GGTGCACATGGGCAAACACCTGG + Exonic
1182994834 22:34802563-34802585 GGTGCCCATGGCCACACAGCTGG + Intergenic
1185224877 22:49646725-49646747 GTTGGATATGGGCACACACCTGG - Intronic
956510174 3:69985134-69985156 GGGCCACATGGGGAAGCACCAGG + Intergenic
958173989 3:89972084-89972106 GGTGCACATGGACATAAACATGG + Intergenic
960263386 3:115593378-115593400 GGGCCACATGGGGAAGCACCAGG + Intergenic
960322389 3:116252172-116252194 GGTGCACATTGGCACACATGTGG - Intronic
961372681 3:126441010-126441032 GGTGAAGAGGGGCACACACCTGG + Intronic
961449446 3:126995847-126995869 GGTGCATCTGGGCATACCCCAGG + Intronic
961643629 3:128380832-128380854 GGTGCACATGTCCCAGCACCAGG - Intronic
961666230 3:128494567-128494589 CAGACACATGGGCAAACACCTGG - Intergenic
965664155 3:171074313-171074335 GGTGCACATGGACACAAAGCTGG + Intronic
968856800 4:3131144-3131166 TGTGCATATGGGCACAAACCAGG + Intronic
970422095 4:15914883-15914905 GGGCCACATGGGGAAGCACCAGG + Intergenic
971379227 4:26081515-26081537 GGTGCTGATGGCCAAAGACCAGG + Intergenic
972390234 4:38606908-38606930 GGTGCACTAGGGCAAGAACCCGG - Intergenic
975890239 4:79018799-79018821 GTTTCACATGGGTAAACATCAGG + Intergenic
976097374 4:81523482-81523504 GGACCACAGGGGCAAACACCAGG + Intronic
980963404 4:139498522-139498544 GGGCCACATGGGGAAGCACCAGG - Intronic
984263027 4:177464789-177464811 ACTGCACATGGGAAATCACCTGG + Intergenic
985678669 5:1244990-1245012 GGTGACCATGGGCAAGCGCCTGG + Intronic
985892893 5:2729924-2729946 GGTGCACATGTGCAGGCTCCAGG + Intergenic
989073943 5:37542555-37542577 GGGGCACATTGGCTCACACCTGG - Intronic
990532460 5:56687898-56687920 GGGGCACATGGAAAAACACCAGG - Intergenic
990608896 5:57437939-57437961 GGTGCATATAGACACACACCTGG - Intergenic
991395918 5:66205331-66205353 GATACACAAGGGCACACACCAGG - Intergenic
995794267 5:115925097-115925119 TGTGCACATGGGCATCCACTGGG + Intergenic
997196879 5:131986190-131986212 GTAGGAGATGGGCAAACACCAGG + Intronic
998857280 5:146405597-146405619 GGACCACATGGGGAAGCACCAGG + Intergenic
999255807 5:150209519-150209541 GGTGCACATGCGCAAGTACGGGG + Exonic
1001801841 5:174551262-174551284 GGTGCCTGTGGACAAACACCAGG - Intergenic
1003798893 6:9639245-9639267 GGTTCATATGAACAAACACCAGG + Intronic
1004075944 6:12344310-12344332 GCTGCTCAAGGGCAAACAGCAGG - Intergenic
1004254774 6:14052959-14052981 GGTGCACATGGGCAGGGACCTGG - Intergenic
1005813775 6:29534261-29534283 CGTGCACATGTGCACACACAGGG - Intergenic
1015195497 6:130521033-130521055 GGGTCACATGGGGAAGCACCAGG - Intergenic
1017014535 6:150089329-150089351 GGTGCAGAAGAGCAAACAACAGG - Intergenic
1019051851 6:169189697-169189719 GCTTCTCATGGGCAAACACAGGG + Intergenic
1020095324 7:5365431-5365453 GGAGCACATGGGCACATAGCTGG + Intronic
1020313463 7:6887298-6887320 AGAGCACATGCGGAAACACCAGG - Intergenic
1020985953 7:15134492-15134514 GGTGCACATGGGCAAAAGGAAGG - Intergenic
1021050295 7:15974903-15974925 GGAACACATGTGCACACACCAGG - Intergenic
1021435288 7:20606624-20606646 GGGCCACATGGGCAACCACTGGG - Intergenic
1023714106 7:43025892-43025914 GGTGCACATGGGGAAGGACCAGG - Intergenic
1023989263 7:45118483-45118505 GGGCCACATGGGAAAACACTGGG + Intergenic
1024371241 7:48586530-48586552 GGTACACATGGGCACAAACATGG + Intronic
1031082636 7:117273242-117273264 GGTGCACACAGGAAAACACAGGG + Intergenic
1033202182 7:139382795-139382817 GGTGCACCTGGGATAAAACCCGG - Intronic
1037284571 8:17284775-17284797 TGTGGACTTGGGCAAAAACCAGG + Intronic
1042014968 8:64298913-64298935 GGGGCACATGTGCAAAGACAGGG + Intergenic
1042524931 8:69754155-69754177 GGTGCACATGGGAAGAGATCAGG + Intronic
1044517371 8:93155052-93155074 GGTGCACATGGAGAAGCACCAGG + Intronic
1044524749 8:93239895-93239917 AGTGCACTTGGGCAAAGAGCAGG - Intergenic
1047465549 8:125109722-125109744 GTTGAACAGGGACAAACACCTGG - Intronic
1050426724 9:5519050-5519072 GGGCCACATGGGGAAGCACCAGG + Intronic
1050668448 9:7968199-7968221 GGGACACATGGGGAATCACCAGG - Intergenic
1051274877 9:15389077-15389099 GGTACACATGGCCAAAAACAAGG + Intergenic
1053661633 9:40287021-40287043 GGTGCACATTGTCATAAACCTGG + Intronic
1053912005 9:42916371-42916393 GGTGCACATTGTCATAAACCTGG + Intergenic
1054373754 9:64433254-64433276 GGTGCACATTGTCATAAACCTGG + Intergenic
1054522975 9:66089263-66089285 GGTGCACATTGTCATAAACCTGG - Intergenic
1059023676 9:110602330-110602352 GGTCCCTATGGGCAGACACCTGG + Intergenic
1059807419 9:117817763-117817785 GGTACACATGGGCATACAGATGG - Intergenic
1061923523 9:133794980-133795002 GGTGCACCTGAGCCAACACCCGG + Intronic
1186649241 X:11541160-11541182 GGGCCACATGGGGAAGCACCAGG + Intronic
1187657031 X:21487934-21487956 GTTGCACATGGGCCTACACTTGG - Intronic
1189991284 X:46597540-46597562 GGTGAAGATGGGAAAACTCCGGG - Intronic
1192509955 X:71715808-71715830 GGTGCACATGAGCTTACACTGGG - Intronic
1192516742 X:71765745-71765767 GGTGCACATGAGCTTACACTGGG + Intronic
1192529085 X:71870932-71870954 GGTGCAGATGGGCTCACACTGGG - Intergenic
1192766627 X:74146610-74146632 GGTGGGGATGGGCAAATACCTGG - Intergenic
1192961951 X:76140486-76140508 GGTGAACATGGGCAAAACCCAGG - Intergenic
1193254795 X:79335032-79335054 GGTACACATGGGCATAAACCTGG - Intergenic
1198506061 X:137302552-137302574 TGTGCACATGTGCACAAACCAGG - Intergenic
1199364645 X:146966326-146966348 GGTGCACATGGACATACAGAAGG + Intergenic
1199659817 X:150037809-150037831 GGGCCACATGGGGAAGCACCAGG - Intergenic
1199809939 X:151339226-151339248 GGCCCACCTGGGCACACACCAGG - Intergenic
1200214484 X:154361547-154361569 GGTGGACGTTGGCAAAGACCAGG - Exonic