ID: 1181176092

View in Genome Browser
Species Human (GRCh38)
Location 22:21036972-21036994
Sequence CCTTGTCACCAGAAACTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181176092_1181176101 13 Left 1181176092 22:21036972-21036994 CCCTACAGTTTCTGGTGACAAGG No data
Right 1181176101 22:21037008-21037030 AAGCCTAAAGATGGGATCCTGGG No data
1181176092_1181176104 30 Left 1181176092 22:21036972-21036994 CCCTACAGTTTCTGGTGACAAGG No data
Right 1181176104 22:21037025-21037047 CCTGGGAGAACAAATAAAAGCGG No data
1181176092_1181176100 12 Left 1181176092 22:21036972-21036994 CCCTACAGTTTCTGGTGACAAGG No data
Right 1181176100 22:21037007-21037029 CAAGCCTAAAGATGGGATCCTGG No data
1181176092_1181176097 4 Left 1181176092 22:21036972-21036994 CCCTACAGTTTCTGGTGACAAGG No data
Right 1181176097 22:21036999-21037021 GATCCTCTCAAGCCTAAAGATGG No data
1181176092_1181176098 5 Left 1181176092 22:21036972-21036994 CCCTACAGTTTCTGGTGACAAGG No data
Right 1181176098 22:21037000-21037022 ATCCTCTCAAGCCTAAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181176092 Original CRISPR CCTTGTCACCAGAAACTGTA GGG (reversed) Intergenic
No off target data available for this crispr